PEX11A (NM_001271572) Human Untagged Clone

CAT#: SC330941

PEX11A (untagged) - Homo sapiens peroxisomal biogenesis factor 11 alpha (PEX11A), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PEX11A
• Synonyms: hsPEX11p; PEX11-ALPHA; PMP28
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271572, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGACGCCTTCACCCGCTTCACCAACCAGACCCAGGGCCGGGACCGACTCTTCAGAGCCACTCAGTACA
  CATGCATGTTGCTTAGATATTTGTTAGAGCCCAAAGCTGGCAAAGAGAAGGTGGTAATGAAGCTCAAGAA
  ACTGGAGTCCAGTGTGAGCACTGGTCGTAAATCCAACCTGAACCGTGTGATTTATTTCATCTGTGACACC
  ATCCTCTGGGTGAGGAGCGTAGGTCTCACCTCTGGCATCAACAAAGAGAAATGGCGAACGAGGGCTGCTC
  ACCACTACTACTATTCTCTTCTGCTGAGCCTGGTCAGGGATCTGTATGAAATCTCCCTGCAGATGAAACG
  AGTTACATGTGACAGGGCAAAGAAAGAGAAATCAGCATCCCAGGATCCTCTTTGGTTCAGCGTGGCTGAG
  GAGGAAACAGAATGGCTCCAATCCTTTCTACTTCTTTTATTCCGATCTCTGAAGCAGCATCCTCCCTTGC
  TCCTGGACACAGTGAAGAACCTTTGTGATATCCTGAACCCTTTGGACCAGCTGGGGATCTATAAATCCAA
  TCCTGGCATCATTGGACTTGGAGGTCTTGTGTCCTCTATAGCAGGCATGATCACTGTGGCATATCCTCAG
  ATGAAGCTGAAGACCCGTTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271572
• ORF Size: 651 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001271572.1, NP_001258501.1
• RefSeq Size: 2649
• RefSeq ORF: 651
• Locus ID: 8800
• Protein Families: Transmembrane
• Gene Summary: This gene is a member of the PEX11 family, which is composed of membrane elongation factors involved in regulation of peroxisome maintenance and proliferation. This gene product interacts with peroxisomal membrane protein 19 and may respond to outside stimuli to increase peroxisome abundance. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
  Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.