PEX11A (NM_001271573) Human Untagged Clone

CAT#: SC330942

PEX11A (untagged) - Homo sapiens peroxisomal biogenesis factor 11 alpha (PEX11A), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PEX11A
• Synonyms: hsPEX11p; PEX11-ALPHA; PMP28
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271573, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAACGAGTTACATGTGACAGGGCAAAGAAAGAGAAATCAGCATCCCAGGATCCTCTTTGGTTCAGCG
  TGGCTGAGGAGGAAACAGAATGGCTCCAATCCTTTCTACTTCTTTTATTCCGATCTCTGAAGCAGCATCC
  TCCCTTGCTCCTGGACACAGTGAAGAACCTTTGTGATATCCTGAACCCTTTGGACCAGCTGGGGATCTAT
  AAATCCAATCCTGGCATCATTGGACTTGGAGGTCTTGTGTCCTCTATAGCAGGCATGATCACTGTGGCAT
  ATCCTCAGATGAAGCTGAAGACCCGTTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271573
• ORF Size: 309 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001271573.1, NP_001258502.1
• RefSeq Size: 2626
• RefSeq ORF: 309
• Locus ID: 8800
• Protein Families: Transmembrane
• Gene Summary: This gene is a member of the PEX11 family, which is composed of membrane elongation factors involved in regulation of peroxisome maintenance and proliferation. This gene product interacts with peroxisomal membrane protein 19 and may respond to outside stimuli to increase peroxisome abundance. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
  Transcript Variant: This variant (3) lacks an exon in the coding region and uses a downstream start codon compared to variant 1. It encodes isoform 3 which has a shorter N-terminus compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.