SESN3 (NM_001271594) Human Untagged Clone

CAT#: SC330943

SESN3 (untagged) - Homo sapiens sestrin 3 (SESN3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SESN3
• Synonyms: SEST3
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271594, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGTTTACACACTCAGTACCTGGAGTCTTTCTTGCGGAGCCAGTTTTACATGTTGCGCATGGATGGTC
  CCCTTCCTCTACCATACAGGCACTATATTGCAATAATGAAACTTGTCAAAACTGGAGAAAATAATTGGTC
  TCTGCCTGAACTGGTACATGCTGTGGTCCTCCTGGCACATTATCATGCTTTGGCAAGCTTTGTTTTTGGT
  AGTGGTATCAATCCAGAGAGAGATCCAGAAATCTCCAATGGATTCAGGCTAATATCAGTCAACAATTTCT
  GCGTTTGTGATCTTGCTAATGACAACAACATAGAGAATGCATCTCTTTCAGGCAGCAACTTTGGGATTGT
  GGATTCTCTAAGTGAGCTAGAGGCCTTAATGGAAAGGATGAAAAGACTTCAAGAAGAAAGGGAAGATGAA
  GAGGCGTCTCAAGAAGAAATGAGCACTCGTTTTGAAAAGGAGAAGAAAGAAAGTCTTTTTGTGGTCTCTG
  GAGATACTTTTCATTCATTTCCTCATTCAGATTTTGAGGATGACATGATTATAACATCTGATGTCTCTCG
  ATATATTGAAGACCCTGGTTTTGGGTATGAAGACTTTGCCAGACGAGGAGAAGAGCATTTGCCAACATTC
  CGAGCTCAGGACTATACCTGGGAAAATCATGGGTTCTCCCTGGTGAACAGACTTTATTCTGACATTGGAC
  ATCTTCTTGATGAAAAGTTTCGGATGGTCTACAATCTCACATATAACACTATGGCCACCCATGAGGATGT
  TGACACAACCATGCTGCGCAGAGCTTTATTTAACTATGTTCACTGTATGTTTGGAATCAGGTATGATGAC
  TATGATTATGGAGAAGTTAATCAATTACTTGAAAGAAGCCTGAAGGTTTACATTAAGACAGTGACCTGCT
  ATCCTGAGAGAACTACAAAACGCATGTATGATAGTTACTGGCGGCAGTTCAAACACTCAGAAAAAGTTCA
  TGTCAATCTACTTTTAATGGAAGCACGAATGCAAGCTGAACTTCTTTATGCTCTTCGTGCCATAACTCGG
  CATTTGACCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271594
• ORF Size: 1062 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_001271594.1, NP_001258523.1
• RefSeq Size: 9345
• RefSeq ORF: 1062
• Locus ID: 143686
• Protein Pathways: p53 signaling pathway
• Gene Summary: This gene encodes a member of the sestrin family of stress-induced proteins. The encoded protein reduces the levels of intracellular reactive oxygen species induced by activated Ras downstream of RAC-alpha serine/threonine-protein kinase (Akt) and FoxO transcription factor. The protein is required for normal regulation of blood glucose, insulin resistance and plays a role in lipid storage in obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
  Transcript Variant: This variant (2) differs in the 5' UTR and uses an alternate in-frame splice site compared to variant 1. It encodes a shorter protein (isoform 2) compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.