APEX2 (NM_001271748) Human Untagged Clone

CAT#: SC330961

APEX2 (untagged) - Homo sapiens APEX nuclease (apurinic/apyrimidinic endonuclease) 2 (APEX2), transcript variant 2


  "NM_001271748" in other vectors (2)

Reconstitution Protocol

USD 350.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "APEX2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol APEX2
Synonyms APE2; APEXL2; XTH2; ZGRF2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001271748, the custom clone sequence may differ by one or more nucleotides


ATGCGCTTCTATCGTTTGCTGCAAATCCGAGCAGAAGCCCTCCTGGCGGCAGGCAGCCATGTGATCATTC
TGGGTGACCTGAATACAGCCCACCGCCCCATTGACCACTGGGATGCAGTCAACCTGGAATGCTTTGAAGA
GGACCCAGGGCGCAAGTGGATGGACAGCTTGCTCAGTAACTTGGGGTGCCAGTCTGCCTCTCATGTAGGG
CCCTTCATCGATAGCTACCGCTGCTTCCAACCAAAGCAGGAGGGGGCCTTCACCTGCTGGTCAGCAGTCA
CTGGCGCCCGCCATCTCAACTATGGCTCCCGGCTTGACTATGTGCTGGGGGACAGGACCCTGGTCATAGA
CACCTTTCAGGCCTCTTTCCTGCTGCCTGAGGTGATGGGCTCTGACCACTGCCCTGTGGGTGCAGTCTTG
AGTGTGTCCTCTGTGCCTGCAAAACAGTGCCCACCTCTGTGCACCCGCTTCCTCCCTGAGTTTGCAGGCA
CCCAGCTCAAGATCCTTCGCTTCCTAGTTCCTCTCGAACAAAGTCCTGTGTTGGAGCAGTCGACGCTGCA
GCACAACAATCAAACCCGGGTACAGACATGCCAAAACAAAGCCCAAGTGCGCTCAACCAGGCCTCAGCCC
AGTCAGGTTGGCTCTAGCAGAGGCCAGAAAAACCTGAAGAGCTACTTTCAGCCCTCCCCTAGCTGTCCCC
AAGCCTCTCCTGACATAGAGCTGCCTAGCCTACCACTGATGAGCGCCCTCATGACCCCGAAGACTCCAGA
AGAGAAGGCAGTGGCCAAAGTGGTGAAGGGGCAGGCCAAGACTTCAGAAGCCAAAGATGAGAAGGAGTTA
CGGACCTCATTCTGGAAGTCTGTGCTGGCGGGGCCCTTGCGCACACCCCTCTGTGGGGGCCACAGGGAGC
CATGTGTGATGCGTACTGTGAAGAAGCCAGGACCCAACTTGGGCCGCCGCTTCTACATGTGTGCCAGGCC
CCGGGGTCCTCCCACTGACCCCTCCTCCCGGTGCAACTTCTTCCTCTGGAGCAGGCCCAGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001271748
ORF Size 1044 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001271748.1, NP_001258677.1
RefSeq Size 1914
RefSeq ORF 1044
Locus ID 27301
Protein Families Druggable Genome
Protein Pathways Base excision repair
Gene Summary Apurinic/apyrimidinic (AP) sites occur frequently in DNA molecules by spontaneous hydrolysis, by DNA damaging agents or by DNA glycosylases that remove specific abnormal bases. AP sites are pre-mutagenic lesions that can prevent normal DNA replication so the cell contains systems to identify and repair such sites. Class II AP endonucleases cleave the phosphodiester backbone 5' to the AP site. This gene encodes a protein shown to have a weak class II AP endonuclease activity. Most of the encoded protein is located in the nucleus but some is also present in mitochondria. This protein may play an important role in both nuclear and mitochondrial base excision repair. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]
Transcript Variant: This variant (2) lacks a 5' exon compared to variant 1. This variant represents translation initiation at a downstream AUG compared to variant 1; the 5'-most initiation codon, as used in variant 1, is associated with a weak Kozak sequence and a truncated ORF that would render the transcript a candidate for nonsense-mediated decay (NMD). Leaky scanning may allow translation initiation at the downstream AUG. The encoded protein (isoform 2) has a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.