APEX2 (NM_001271748) Human Untagged Clone
CAT#: SC330961
APEX2 (untagged) - Homo sapiens APEX nuclease (apurinic/apyrimidinic endonuclease) 2 (APEX2), transcript variant 2
"NM_001271748" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | APEX2 |
Synonyms | APE2; APEXL2; XTH2; ZGRF2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001271748, the custom clone sequence may differ by one or more nucleotides
ATGCGCTTCTATCGTTTGCTGCAAATCCGAGCAGAAGCCCTCCTGGCGGCAGGCAGCCATGTGATCATTC TGGGTGACCTGAATACAGCCCACCGCCCCATTGACCACTGGGATGCAGTCAACCTGGAATGCTTTGAAGA GGACCCAGGGCGCAAGTGGATGGACAGCTTGCTCAGTAACTTGGGGTGCCAGTCTGCCTCTCATGTAGGG CCCTTCATCGATAGCTACCGCTGCTTCCAACCAAAGCAGGAGGGGGCCTTCACCTGCTGGTCAGCAGTCA CTGGCGCCCGCCATCTCAACTATGGCTCCCGGCTTGACTATGTGCTGGGGGACAGGACCCTGGTCATAGA CACCTTTCAGGCCTCTTTCCTGCTGCCTGAGGTGATGGGCTCTGACCACTGCCCTGTGGGTGCAGTCTTG AGTGTGTCCTCTGTGCCTGCAAAACAGTGCCCACCTCTGTGCACCCGCTTCCTCCCTGAGTTTGCAGGCA CCCAGCTCAAGATCCTTCGCTTCCTAGTTCCTCTCGAACAAAGTCCTGTGTTGGAGCAGTCGACGCTGCA GCACAACAATCAAACCCGGGTACAGACATGCCAAAACAAAGCCCAAGTGCGCTCAACCAGGCCTCAGCCC AGTCAGGTTGGCTCTAGCAGAGGCCAGAAAAACCTGAAGAGCTACTTTCAGCCCTCCCCTAGCTGTCCCC AAGCCTCTCCTGACATAGAGCTGCCTAGCCTACCACTGATGAGCGCCCTCATGACCCCGAAGACTCCAGA AGAGAAGGCAGTGGCCAAAGTGGTGAAGGGGCAGGCCAAGACTTCAGAAGCCAAAGATGAGAAGGAGTTA CGGACCTCATTCTGGAAGTCTGTGCTGGCGGGGCCCTTGCGCACACCCCTCTGTGGGGGCCACAGGGAGC CATGTGTGATGCGTACTGTGAAGAAGCCAGGACCCAACTTGGGCCGCCGCTTCTACATGTGTGCCAGGCC CCGGGGTCCTCCCACTGACCCCTCCTCCCGGTGCAACTTCTTCCTCTGGAGCAGGCCCAGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271748 |
ORF Size | 1044 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001271748.1, NP_001258677.1 |
RefSeq Size | 1914 |
RefSeq ORF | 1044 |
Locus ID | 27301 |
Protein Families | Druggable Genome |
Protein Pathways | Base excision repair |
Gene Summary | Apurinic/apyrimidinic (AP) sites occur frequently in DNA molecules by spontaneous hydrolysis, by DNA damaging agents or by DNA glycosylases that remove specific abnormal bases. AP sites are pre-mutagenic lesions that can prevent normal DNA replication so the cell contains systems to identify and repair such sites. Class II AP endonucleases cleave the phosphodiester backbone 5' to the AP site. This gene encodes a protein shown to have a weak class II AP endonuclease activity. Most of the encoded protein is located in the nucleus but some is also present in mitochondria. This protein may play an important role in both nuclear and mitochondrial base excision repair. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012] Transcript Variant: This variant (2) lacks a 5' exon compared to variant 1. This variant represents translation initiation at a downstream AUG compared to variant 1; the 5'-most initiation codon, as used in variant 1, is associated with a weak Kozak sequence and a truncated ORF that would render the transcript a candidate for nonsense-mediated decay (NMD). Leaky scanning may allow translation initiation at the downstream AUG. The encoded protein (isoform 2) has a shorter N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232544 | APEX2 (Myc-DDK tagged) - Homo sapiens APEX nuclease (apurinic/apyrimidinic endonuclease) 2 (APEX2), transcript variant 2 |
USD 420.00 |
|
RG232544 | APEX2 (GFP-tagged) - Homo sapiens APEX nuclease (apurinic/apyrimidinic endonuclease) 2 (APEX2), transcript variant 2 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review