PLA2G2D (NM_001271814) Human Untagged Clone

CAT#: SC330972

PLA2G2D (untagged) - Homo sapiens phospholipase A2, group IID (PLA2G2D), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PLA2G2D
• Synonyms: PLA2IID; sPLA2-IID; sPLA2S; SPLASH
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271814, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAACTTGCACTGCTGTGTGGGCTGGTGGTGATGGCTGGTGTGATTCCAATCCAGGGCGGGATCCTGA
  ACCTGAACAAGATGGTCAAGCAAGTGACTGGGAAAATGCCCATCCTCTCCTACTGGCCCTACGGCTGTCA
  CTGCGGACTAGGTGGCAGAGGCCAACCCAAAGATGCCACGGACTGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271814
• ORF Size: 189 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001271814.1, NP_001258743.1
• RefSeq Size: 1878
• RefSeq ORF: 189
• Locus ID: 26279
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Protein Pathways: alpha-Linolenic acid metabolism, Arachidonic acid metabolism, Ether lipid metabolism, Fc epsilon RI signaling pathway, Glycerophospholipid metabolism, GnRH signaling pathway, Linoleic acid metabolism, Long-term depression, MAPK signaling pathway, Metabolic pathways, Vascular smooth muscle contraction, VEGF signaling pathway
• Gene Summary: This gene encodes a secreted member of the phospholipase A2 family, and is found in a cluster of related family members on chromosome 1. Phospholipase A2 family members hydrolyze the sn-2 fatty acid ester bond of glycerophospholipids to produce lysophospholipids and free fatty acid. This gene may be involved in inflammation and immune response, and in weight loss associated with chronic obstructive pulmonary disease. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2012]
  Transcript Variant: This variant (2) lacks an internal exon in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a shorter and distinct C-terminus, compared to isoform 1.