TREM2 (NM_001271821) Human Untagged Clone
CAT#: SC330976
TREM2 (untagged) - Homo sapiens triggering receptor expressed on myeloid cells 2 (TREM2), transcript variant 2
"NM_001271821" in other vectors (2)
Product Images
Other products for "TREM2"
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | TREM2 |
| Synonyms | PLOSL2; TREM-2; Trem2a; Trem2b; Trem2c |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001271821, the custom clone sequence may differ by one or more nucleotides
ATGGAGCCTCTCCGGCTGCTCATCTTACTCTTTGTCACAGAGCTGTCCGGAGCCCACAACACCACAGTGT TCCAGGGCGTGGCGGGCCAGTCCCTGCAGGTGTCTTGCCCCTATGACTCCATGAAGCACTGGGGGAGGCG CAAGGCCTGGTGCCGCCAGCTGGGAGAGAAGGGCCCATGCCAGCGTGTGGTCAGCACGCACAACTTGTGG CTGCTGTCCTTCCTGAGGAGGTGGAATGGGAGCACAGCCATCACAGACGATACCCTGGGTGGCACTCTCA CCATTACGCTGCGGAATCTACAACCCCATGATGCGGGTCTCTACCAGTGCCAGAGCCTCCATGGCAGTGA GGCTGACACCCTCAGGAAGGTCCTGGTGGAGGTGCTGGCAGACCCCCTGGATCACCGGGATGCTGGAGAT CTCTGGTTCCCCGGGGAGTCTGAGAGCTTCGAGGATGCCCATGTGGAGCACAGCATCTCCAGGGCTGAGA GACACGTGAAGGAAGATGATGGGAGGAAAAGCCCAGGAGAAGTCCCACCAGGGACCAGCCCAGCCTGCAT ACTTGCCACTTGGCCACCAGGACTCCTTGTTCTGCTCTGGCAAGAGACTACTCTGCCTGAACACTGCTTC TCCTGGACCCTGGAAGCAGGGACTGGTTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001271821 |
| ORF Size | 660 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Reference Data | |
| RefSeq | NM_001271821.1, NP_001258750.1 |
| RefSeq Size | 882 |
| RefSeq ORF | 660 |
| Locus ID | 54209 |
| Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
| Gene Summary | This gene encodes a membrane protein that forms a receptor signaling complex with the TYRO protein tyrosine kinase binding protein. The encoded protein functions in immune response and may be involved in chronic inflammation by triggering the production of constitutive inflammatory cytokines. Defects in this gene are a cause of polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy (PLOSL). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2012] Transcript Variant: This variant (2), alternately referred to as TREM-2V, lacks a 3' coding exon which results in a frameshift, compared to variant 1. The resulting isoform (2) is shorter compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Germany
Japan
United Kingdom
China