HIGD1B (NM_001271880) Human Untagged Clone

CAT#: SC330992

HIGD1B (untagged) - Homo sapiens HIG1 hypoxia inducible domain family, member 1B (HIGD1B), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HIGD1B
• Synonyms: CLST11240; CLST11240-15
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271880, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCTGCTAACAGACGCTGGTGGGTACCACCTGACGACGAAGACTGTGTGTCTGAGAAGCTCCTGAGGA
  AGACTCGGGAATCTCCACTGGTGCCTATAGGCTTAGGAGGCTGCTTGGTGGTAGCAGCATACAGGATTTA
  CCGGCTGAGGTCTCGTGGTTCCACCAAGATGTCCATACACCTGATTCACACCCGAGTGGCAGCGCAGGCC
  TGTGCAGTGGGTGCAATCATGCTAGGTGCTGTGTACACAATGTACAGCGATTACGTCAAGAGGATGGCAC
  AGGATGCTGGAGAGAAGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271880
• ORF Size: 300 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001271880.1, NP_001258809.1
• RefSeq Size: 558
• RefSeq ORF: 300
• Locus ID: 51751
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a member of the hypoxia inducible gene 1 (HIG1) domain family. The encoded protein is localized to the cell membrane and has been linked to tumorigenesis and the progression of pituitary adenomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein.