AAGAB (NM_001271885) Human Untagged Clone

CAT#: SC330993

AAGAB (untagged) - Homo sapiens alpha- and gamma-adaptin binding protein (AAGAB), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: AAGAB
• Synonyms: KPPP1; p34; PPKP1; PPKP1A
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271885, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATCTTGGTCTGCGATAGAGTGTCTGAAGATGGTATAAACCGACAAAAAGCTCAAGAATGGTGCATCA
  AACATGGCTTTGAATTGGTAGAACTTAGTCCAGAGGAGTTGCCTGAGGAGGATGATGACTTCCCAGAATC
  TACAGGAGTAAAGCGAATTGTCCAAGCCCTGAATGCCAATGTGTGGTCCAATGTAGTGATGAAGAATGAT
  AGGAACCAAGGCTTTAGCCTTCTCAACTCATTGACTGGAACAAACCATAGCATTGGGTCAGCAGATCCCT
  GTCACCCAGAGCAACCCCATTTGCCAGCAGCAGATAGTACTGAATCCCTCTCTGATCATCGGGGTGGTGC
  ATCTAACACAACAGATGCCCAGGTTGATAGCATTGTGGATCCCATGTTAGATCTGGATATTCAAGAATTA
  GCCAGTCTTACCACTGGAGGAGGAGATGTGGAGAATTTTGAAAGACTCTTTTCAAAGTTAAAGGAAATGA
  AAGACAAGGCTGCGACGCTTCCTCATGAGCAAAGAAAAGTGCATGCAGAAAAGGTGGCCAAAGCATTCTG
  GATGGCAATCGGGGGAGACAGAGATGAAATTGAAGGCCTTTCATCTGATGAAGAGCACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271885
• ORF Size: 621 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001271885.1, NP_001258814.1
• RefSeq Size: 3083
• RefSeq ORF: 621
• Locus ID: 79719
• Gene Summary: The protein encoded by this gene interacts with the gamma-adaptin and alpha-adaptin subunits of complexes involved in clathrin-coated vesicle trafficking. Mutations in this gene are associated with type I punctate palmoplantar keratoderma. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2012]
  Transcript Variant: This variant (2) contains an alternate 5' terminal exon, which causes translation initiation from an in-frame downstream start codon compared to variant 1. The resulting isoform (2) has a shorter N-terminus compared to isoform 1. Variants 2 and 3 encode the same isoform.