SEC11A (NM_001271918) Human Untagged Clone

CAT#: SC331004

SEC11A (untagged) - Homo sapiens SEC11 homolog A (S. cerevisiae) (SEC11A), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SEC11A
• Synonyms: 1810012E07Rik; SEC11L1; sid2895; SPC18; SPCS4A
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271918, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATTGTCTCATCGGCACTAATGATCTGGAAGGGGTTAATGGTAATAACTGGAAGTGAAAGTCCGATTG
  TAGTGGTGCTCAGTGGCAGCATGGAACCTGCATTTCATAGAGGAGATCTTCTCTTTCTAACAAATCGAGT
  TGAAGATCCCATACGAGTGGGAGAAATTGTTGTTTTTAGGATAGAAGGAAGAGAGATTCCTATAGTTCAC
  CGAGTCTTGAAGATTCATGAAAAGCAAAATGGGCATATCAAGTTTTTGACCAAAGGAGATAATAATGCGG
  TTGATGACCGAGGCCTCTATAAACAAGGACAACATTGGCTAGAGAAAAAAGATGTTGTGGGGAGAGCCAG
  GGGATTTGTTCCTTATATTGGAATTGTGACGATCCTCATGAATGACTATCCTAAATTTAAGTATGCAGTT
  CTCTTTTTGCTGGGTTTATTCGTGCTGGTTCATCGTGAGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271918
• ORF Size: 462 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001271918.1, NP_001258847.1
• RefSeq Size: 1560
• RefSeq ORF: 462
• Locus ID: 23478
• Protein Families: Druggable Genome, Protease, Transmembrane
• Protein Pathways: Protein export
• Gene Summary: This gene encodes a member of the peptidase S26B family. The encoded protein is an 18kDa subunit of the signal peptidase complex and has been linked to cell migration and invasion, gastric cancer and lymph node metastasis. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 8. [provided by RefSeq, Dec 2012]
  Transcript Variant: This variant (5) uses an alternate exon in the 5' coding region which results in initiation at a downstream start site and an alternate in-frame exon in the central coding region, compared to variant 1. The encoded isoform (5) is longer than isoform 1.