CREB3L3 (NM_001271997) Human Untagged Clone

CAT#: SC331019

CREB3L3 (untagged) - Homo sapiens cAMP responsive element binding protein 3-like 3 (CREB3L3), transcript variant 4


  "NM_001271997" in other vectors (2)

Reconstitution Protocol

USD 340.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "CREB3L3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CREB3L3
Synonyms CREB-H; CREBH; HYST1481
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001271997, the custom clone sequence may differ by one or more nucleotides


ATGAATACGGATTTAGCTGCTGGAAAGATGGCTTCTGCTGCCTGCTCCATGGACCCCATCGACAGCTTTG
AGCTCCTGGATCTCCTGTTTGACCGGCAGGACGGCATCCTGAGACACGTGGAGCTGGGCGAGGGCTGGGG
TCACGTCAAGGACCAGCAGGTCCTGCCAAACCCCGACTCTGACGACTTCCTCAGCTCCATCCTGGGCTCT
GGAGACTCACTGCCCAGCTCCCCACTCTGGTCCCCCGAAGGCAGTGATAGTGGCATCTCCGAAGACCTCC
CCTCCGACCCCCAGGACACCCCTCCACGCAGCGGACCAGCCACCTCCCCCGCCGGCTGCCATCCTGCCCA
GCCTGGCAAGGGGCCCTGCCTCTCCTATCATCCTGGCAACTCTTGCTCCACCACAACCCCAGGGCCAGTG
ATCCAAGTACCTGAAGCCTCTGTGACCATAGACCTGGAAATGTGGAGCCCAGGAGGAAGGATCTGTGCTG
AGAAGCCGGCTGATCCGGTGGACCTGTCCCCACGATGCAATCTCACCGTGAAAGACCTCCTCCTTTCGGG
CAGCAGTGGGGACCTGCAACAGCATCACCTGGGGGCCTCCTACCTCCTGCGACCTGGGGCTGGGCACTGT
CAGGAGCTGGTGCTCACCGAGGATGAGAAGAAGCTGCTGGCTAAAGAAGGCATCACCCTGCCCACTCAGC
TGCCCCTCACTAAGGATGTCAGCTTGCACTGCTCAGAATCAGGAGTTACAGAGGAAAGTCTTGCATCTCG
AGAAGCAAAACCTGTCCCTCTTGGAGCAACTGAAGAAACTCCAGGCCATTGTGGTGCAGTCCACCAGCAA
GTCAGCCCAGACAGGCACCTGTGTCGCAGTCCTGTTGCTGTCCTTTGCCCTCATCATCCTCCCCTCCATC
AGCCCTTTTGGCCCCAACAAAACCGAGAGCCCTGGGGACTTTGCGCCTGTACGAGTGTTCTCCAGAACTT
TGCACAACGATGCTGCCTCCCGCGTGGCTGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001271997
ORF Size 1014 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001271997.1, NP_001258926.1
RefSeq Size 2517
RefSeq ORF 1014
Locus ID 84699
Protein Families Transcription Factors
Protein Pathways Huntington's disease, Melanogenesis, Prostate cancer
Gene Summary This gene encodes a member of the basic-leucine zipper family and the AMP-dependent transcription factor family. The encoded protein is localized to the endoplasmic reticulum and acts as a transcription factor activated by cyclic AMP stimulation. The encoded protein binds the cyclic AMP response element (CRE) and the box-B element and has been linked to acute inflammatory response, hepatocellular carcinoma, triglyceride metabolism, and hepcidin expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (4) lacks an exon in the coding region which results in a frameshift, compared to variant 1. The encoded isoform (d) is shorter and has a distinct C-terminus, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.