ABHD10 (NM_001272069) Human Untagged Clone

CAT#: SC331032

ABHD10 (untagged) - Homo sapiens abhydrolase domain containing 10 (ABHD10), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ABHD10
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001272069, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGTTGCGCGCTTGGCAGCTGTGGCGGCCTGGGTACCTTGTCGGAGCTGGGGCTGGGCAGCCGTCC
  CCTTCGGTCCCCACCGTGGCCTCAGCGTGCTGCTTGCACGGATACCTCAGCGGGCGCCACGGTGGCTCCC
  AGCTTGTAGACAAAAGACGTCACTCTCATTCCTTAATCGACCAGACCTTCCAAACCTGGCTTATAAGAAG
  CTAAAAGGCAAAAGTCCAGGAATTATCTTCATCCCTGGCTATCTTTCTTATATGAATGGTACAAAAGCGT
  TGGCGATTGAGGAGTTTTGCAAATCTCTAGGTCACGCCTGCATAAGGTTTGATTACTCAGGAGTTGGAAG
  TTCAGATGGTAACTCAGAGGAAAGCACACTGGGGAAATGGAGAAAAGATGTTCTTTCTATAATTGATGAC
  TTAGCTGATGGGCCACAGATTCTTGTTGGATCTAGCCTTGGAGGGTGGCTTATGCTTCATGCTGCAATTG
  CACGACCAGAGAAGGTCGTGGCTCTTATTGGTGTAGCTACAGCTGCAGATACCTTAGTGACAAAGTTTAA
  TCAGCTTCCTGTTGAGGACTCTGGAAGGAAAAACTATATTTCTTTACATTCAGCCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001272069
• ORF Size: 618 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001272069.1, NP_001258998.1
• RefSeq Size: 2823
• RefSeq ORF: 618
• Locus ID: 55347
• Gene Summary: This gene encodes a mitochondrially-localized enzyme that acts in liver cells as a hydrolase. The encoded protein removes glucuronide from mycophenolic acid acyl-glucuronide. There is a pseudogene for this gene on chromosome 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
  Transcript Variant: This variant (2) contains an alternate exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.