RGS3 (NM_001276262) Human Untagged Clone

CAT#: SC331036

RGS3 (untagged) - Homo sapiens regulator of G-protein signaling 3 (RGS3), transcript variant 9


  "NM_001276262" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RGS3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RGS3
Synonyms C2PA; RGP3
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001276262, the custom clone sequence may differ by one or more nucleotides


ATGAAGAACAAGCTGGGGATCTTCAGACGGCGGAATGAGTCCCCTGGAGCCCCTCCCGCGGGCAAGGCAG
ACAAAATGATGAAGTCATTCAAGCCCACCTCAGAGGAAGCCCTCAAGTGGGGCGAGTCCTTGGAGAAGCT
GCTGGTTCACAAATACGGGTTAGCAGTGTTCCAAGCCTTCCTTCGCACTGAGTTCAGTGAGGAGAATCTG
GAGTTCTGGTTGGCTTGTGAGGACTTCAAGAAGGTCAAGTCACAGTCCAAGATGGCATCCAAGGCCAAGA
AGATCTTTGCTGAATACATCGCGATCCAGGCATGCAAGGAGGTCAACCTGGACTCCTACACGCGGGAGCA
CACCAAGGACAACCTGCAGAGCGTCACGCGGGGCTGCTTCGACCTGGCACAGAAGCGCATCTTCGGGCTC
ATGGAAAAGGACTCGTACCCTCGCTTTCTCCGTTCTGACCTCTACCTGGACCTTATTAACCAGAAGAAGA
TGAGTCCCCCGCTTTAG


Restriction Sites SgfI-MluI     
ACCN NM_001276262
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001276262.1, NP_001263191.1
RefSeq Size 1459 bp
RefSeq ORF 507 bp
Locus ID 5998
Cytogenetics 9q32
Protein Families Druggable Genome
Protein Pathways Axon guidance
Gene Summary 'This gene encodes a member of the regulator of G-protein signaling (RGS) family. This protein is a GTPase-activating protein that inhibits G-protein-mediated signal transduction. Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding different isoforms. Long isoforms are largely cytosolic and plasma membrane-associated with a function in Wnt signaling and in the epithelial mesenchymal transition, while shorter N-terminally-truncated isoforms can be nuclear. [provided by RefSeq, Jan 2013]'
Transcript Variant: This variant (9) lacks several 5' exons but includes an alternate 5' exon, and it thus differs in the 5' UTR, lacks a large portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 6. The encoded isoform (4, also known as RGS3S in PubMedID:11330340) is significantly shorter at the N-terminus, compared to isoform 6. Both variants 4 and 9 encode isoform 4.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.