STMN3 (NM_001276310) Human Untagged Clone

CAT#: SC331042

STMN3 (untagged) - Homo sapiens stathmin-like 3 (STMN3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: STMN3
• Synonyms: SCLIP
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001276310, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGGAGCTGTCGGTGCTGTCGCTCATCTGCTCCTGCTTCTACACACAGCCGCACCCCAATACCGTCT
  ACCAGTACGGGGACATGGAGGTGAAGCAGCTGGACAAGCGGGCCTCAGGCCAGAGCTTCGAGGTCATCCT
  CAAGTCCCCTTCTGACCTGTCCCCAGAGAGCCCTATGCTCTCCTCCCCACCCAAGAAGAAGGACACCTCC
  CTGGAGGAGCTGCAAAAGCGGCTGGAGGCAGCCGAGGAGCGGAGGAAGACGCAGGAGGCGCAGGTGCTGA
  AGCAGCTGGCGGAGCGGCGCGAGCACGAGCGCGAGGTGCTGCACAAGGCGCTGGAGGAGAATAACAACTT
  CAGCCGCCAGGCGGAGGAGAAGCTCAACTACAAGATGGAGCTCAGCAAGGAGATCCGCGAGGCACACCTG
  GCCGCACTGCGCGAGCGGCTGCGCGAGAAGGAGCTGCACGCGGCCGAGGTGCGCAGGAACAAGGAGCAGC
  GAGAAGAGATGTCGGGCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001276310
• ORF Size: 510 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001276310.1, NP_001263239.1
• RefSeq Size: 2351
• RefSeq ORF: 510
• Locus ID: 50861
• Gene Summary: This gene encodes a protein which is a member of the stathmin protein family. Members of this protein family form a complex with tubulins at a ratio of 2 tubulins for each stathmin protein. Microtubules require the ordered assembly of alpha- and beta-tubulins, and formation of a complex with stathmin disrupts microtubule formation and function. A pseudogene of this gene is located on chromosome 22. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
  Transcript Variant: This variant (2) contains an alternate 5' exon and uses a downstream start codon, compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct N-terminus compared to isoform 1.