KCNJ15 (NM_001276438) Human Untagged Clone

CAT#: SC331058

KCNJ15 (untagged) - Homo sapiens potassium inwardly-rectifying channel, subfamily J, member 15 (KCNJ15), transcript variant 7


  "NM_001276438" in other vectors (2)

Reconstitution Protocol

USD 380.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "KCNJ15"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KCNJ15
Synonyms IRKK; KIR1.3; KIR4.2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001276438, the custom clone sequence may differ by one or more nucleotides


ATGGATGCCATTCACATCGGCATGTCCAGCACCCCCCTGGTGAAGCACACTGCTGGGGCTGGGCTCAAGG
CCAACAGACCCCGCGTCATGTCCAAGAGTGGGCACAGCAACGTGAGAATTGACAAAGTGGATGGCATATA
CCTACTCTACCTGCAAGACCTGTGGACCACAGTTATCGACATGAAGTGGAGATACAAACTCACCCTGTTC
GCTGCCACTTTTGTGATGACCTGGTTCCTTTTTGGAGTCATCTACTATGCCATCGCGTTTATTCATGGGG
ACTTAGAACCCGGTGAGCCCATTTCAAATCATACCCCCTGCATCATGAAAGTGGACTCTCTCACTGGGGC
GTTTCTCTTTTCCCTGGAATCCCAGACAACCATTGGCTATGGAGTCCGTTCCATCACAGAGGAATGTCCT
CATGCCATCTTCCTGTTGGTTGCTCAGTTGGTCATCACGACCTTGATTGAGATCTTCATCACCGGAACCT
TCCTGGCCAAAATCGCCAGACCCAAAAAGCGGGCTGAGACCATCAAGTTCAGCCACTGTGCAGTCATCAC
CAAGCAGAATGGGAAGCTGTGCTTGGTGATTCAGGTAGCCAATATGAGGAAGAGCCTCTTGATTCAGTGC
CAGCTCTCTGGCAAGCTCCTGCAGACCCACGTCACCAAGGAGGGGGAGCGGATTCTCCTCAACCAAGCCA
CTGTCAAATTCCACGTGGACTCCTCCTCTGAGAGCCCCTTCCTCATTCTGCCCATGACATTCTACCATGT
GCTGGATGAGACGAGCCCCCTGAGAGACCTCACACCCCAAAACCTAAAGGAGAAGGAGTTTGAGCTTGTG
GTCCTCCTCAATGCCACTGTGGAATCCACCAGCGCTGTCTGCCAGAGCCGAACATCTTATATCCCAGAGG
AAATCTACTGGGGTTTTGAGTTTGTGCCTGTGGTATCTCTCTCCAAAAATGGAAAATATGTGGCTGATTT
CAGTCAGTTTGAACAGATTCGGAAAAGCCCAGATTGCACATTTTACTGTGCAGATTCTGAGAAACAGCAA
CTCGAGGAGAAGTACAGGCAGGAGGATCAGAGGGAAAGAGAACTGAGGACACTTTTATTACAACAGAGCA
ATGTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001276438
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001276438.1, NP_001263367.1
RefSeq Size 2821 bp
RefSeq ORF 1128 bp
Locus ID 3772
Cytogenetics 21q22.13-q22.2
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
Gene Summary 'Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein has a greater tendency to allow potassium to flow into a cell rather than out of a cell. Eight transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2013]'
Transcript Variant: This variant (7) has an alternate 5'-most exon in the 5' UTR compared to variant 1. All eight variants encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.