SERPINB8 (NM_001276490) Human Untagged Clone

CAT#: SC331065

SERPINB8 (untagged) - Homo sapiens serpin peptidase inhibitor, clade B (ovalbumin), member 8 (SERPINB8), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SERPINB8
• Synonyms: C18orf53; CAP2; PI-8; PI8; PSS5
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001276490, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTCTTTAAAACCAACGAGGAAAAAAAGACAGTGCAGATGATGTTTAAGGAAGCTAAGTTTAAAATGG
  GGTATGCGGATGAGGTACACACCCAGGTCCTGGAGCTGCCCTATGTGGAAGAGGAGCTGAGCATGGTCAT
  TCTGCTTCCCGATGACAACACGGACCTCGCCGTGGTGGAAAAAGCACTTACATATGAGAAATTCAAAGCC
  TGGACAAATTCAGAAAAGTTGACAAAAAGTAAGGTTCAAGTTTTCCTTCCCAGATTAAAGCTGGAGGAGA
  GTTATGACTTGGAGCCTTTCCTTCGAAGATTAGGAATGATCGATGCTTTTGACGAAGCCAAGGCAGACTT
  TTCTGGAATGTCAACTGAGAAGAATGTGCCTCTGTCCAAGGTTGCCCACAAGTGCTTCGTGGAGGTCAAT
  GAGGAAGGCACAGAGGCTGCCGCAGCCACTGCTGTGGTCAGGAATTCCCGGTGCAGCAGAATGGAGCCAA
  GATTCTGTGCAGACCACCCTTTTCTTTTCTTCATCAGGCACCACAAAACCAACTGCATCTTGTTCTGTGG
  CAGGTTCTCTTCTCCGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001276490
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001276490.1, NP_001263419.1
• RefSeq Size: 3212 bp
• RefSeq ORF: 579 bp
• Locus ID: 5271
• Cytogenetics: 18q22.1
• Protein Families: Druggable Genome
• Gene Summary: 'The protein encoded by this gene is a member of the ov-serpin family of serine protease inhibitors. The encoded protein is produced by platelets and can bind to and inhibit the function of furin, a serine protease involved in platelet functions. In addition, this protein has been found to enhance the mechanical stability of cell-cell adhesion in the skin, and defects in this gene have been associated with an autosomal-recessive form of exfoliative ichthyosis. [provided by RefSeq, Jan 2017]'
  Transcript Variant: This variant (4) uses an alternate splice junction in the 5' UTR and lacks the alternate exon containing the translation start site compared to variant 2. The resulting isoform (c) is shorter at the N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.