MFF (NM_001277064) Human Untagged Clone

CAT#: SC331080

MFF (untagged) - Homo sapiens mitochondrial fission factor (MFF), transcript variant 5


  "NM_001277064" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MFF
Synonyms C2orf33; EMPF2; GL004
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001277064, the custom clone sequence may differ by one or more nucleotides


ATGGCAGAAATTAGTCGAATTCAGTACGAAATGGAATATACTGAAGGCATTAGTCAGCGAATGAGGGTCC
CAGAAAAGTTAAAAGTAGCACCGCCAAACGCTGACCTGGAACAAGGATTCCAAGAAGGAGTTCCAAATGC
TAGTGTGATAATGCAAGTTCCGGAGAGGATTGTTGTAGCAGGAAATAATGAAGATGTTTCATTTTCAAGA
CCAGCAGATCTTGACCTTATTCAGTCAACTCCCTTTAAACCCCTGGCACTGAAAACACCACCTCGTGTAC
TTACGCTGAGTGAAAGACCACTAGATTTTCTGGATTTAGAAAGACCTCCTACAACCCCTCAAAATGAAGA
AATCCGAGCAGTTGGCAGACTAAAAAGAGAGCGGTCTATGAGTGAAAATGCTGTTCGCCAAAATGGACAG
CTGGTCAGAAATGATTCTCTACCTGTGTTGCGTGGTGGGTCTGCTGCCGCCACTTCTAATCCTCATCATG
ACAACGTCAGGTATGGCATTTCAAATATAGATACAACCATTGAAGGAACGTCAGATGACCTGACTGTTGT
AGATGCAGCTTCACTAAGACGACAGATAATCAAACTAAATAGACGTCTACAACTTCTGGAAGAGGAGAAC
AAAGAACGTGCTAAAAGAGAAATGGTCATGTATTCAATTACTGTAGCTTTCTGGCTGCTTAATAGCTGGC
TCTGGTTTCGCCGCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001277064
ORF Size 717 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001277064.1, NP_001263993.1
RefSeq Size 1865
RefSeq ORF 717
Locus ID 56947
Protein Families Transmembrane
Gene Summary This is a nuclear gene encoding a protein that functions in mitochondrial and peroxisomal fission. The encoded protein recruits dynamin-1-like protein (DNM1L) to mitochondria. There are multiple pseudogenes for this gene on chromosomes 1, 5, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Transcript Variant: This variant (5) differs in the 5' UTR, lacks a portion of the 5' coding region and lacks two in-frame exons, compared to variant 1. It initiates translation at a downstream in-frame start codon. The encoded isoform (d) is shorter and has a shorter N-terminus than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.