MFF (NM_001277065) Human Untagged Clone
CAT#: SC331081
MFF (untagged) - Homo sapiens mitochondrial fission factor (MFF), transcript variant 6
"NM_001277065" in other vectors (2)
Product Images
Other products for "MFF"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MFF |
Synonyms | C2orf33; EMPF2; GL004 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001277065, the custom clone sequence may differ by one or more nucleotides
ATGGCAGAAATTAGTCGAATTCAGTACGAAATGGAATATACTGAAGGCATTAGTCAGCGAATGAGGGTCC CAGAAAAGTTAAAAGTAGCACCGCCAAACGCTGACCTGGAACAAGGATTCCAAGAAGGAGTTCCAAATGC TAGTGTGATAATGCAAGTTCCGGAGAGGATTGTTGTAGCAGGAAATAATGAAGATGTTTCATTTTCAAGA CCAGCAGATCTTGACCTTATTCAGTCAACTCCCTTTAAACCCCTGGCACTGAAAACACCACCTCGTGTAC TTACGCTGAGTGAAAGACCACTAGATTTTCTGGATTTAGAAAGACCTCCTACAACCCCTCAAAATGAAGA AATCCGAGCAGTTGGCAGACTAAAAAGAGAGCGGTCTATGAGTGAAAATGCTGTTCGCCAAAATGGACAG CTGGTCAGAAATGATTCTCTGTATGGCATTTCAAATATAGATACAACCATTGAAGGAACGTCAGATGACC TGACTGTTGTAGATGCAGCTTCACTAAGACGACAGATAATCAAACTAAATAGACGTCTACAACTTCTGGA AGAGGAGAACAAAGAACGTGCTAAAAGAGAAATGGTCATGTATTCAATTACTGTAGCTTTCTGGCTGCTT AATAGCTGGCTCTGGTTTCGCCGCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001277065 |
ORF Size | 657 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001277065.1, NP_001263994.1 |
RefSeq Size | 1805 |
RefSeq ORF | 657 |
Locus ID | 56947 |
Protein Families | Transmembrane |
Gene Summary | This is a nuclear gene encoding a protein that functions in mitochondrial and peroxisomal fission. The encoded protein recruits dynamin-1-like protein (DNM1L) to mitochondria. There are multiple pseudogenes for this gene on chromosomes 1, 5, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013] Transcript Variant: This variant (6) differs in the 5' UTR, lacks a portion of the 5' coding region and an lacks three in-frame exons, compared to variant 1. It initiates translation at a downstream in-frame start codon. The encoded isoform (e) is shorter and has a shorter N-terminus than isoform a. Both variants 6 and 7 encode the same isoform (e). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.