HOMER1 (NM_001277078) Human Untagged Clone

CAT#: SC331083

HOMER1 (untagged) - Homo sapiens homer homolog 1 (Drosophila) (HOMER1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HOMER1
• Synonyms: HOMER; HOMER1A; HOMER1B; HOMER1C; SYN47; Ves-1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001277078, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGGAACAACCTATCTTCAGCACTCGAGCTCATGTCTTCCAAATTGACCCAAACACAAAGAAGAACT
  GGGTACCCACCAGCAAGCATGCAGTTACTGTGTCTTATTTCTATGACAGCACAAGAAATGTGTATAGGAT
  AATCAGTTTAGATGGCTCAAAGGCAATAATAAATAGTACCATCACCCCAAACATGACATTTACTAAAACA
  TCTCAGAAGTTTGGCCAGTGGGCTGATAGCCGGGCAAACACCGTTTATGGATTGGGATTCTCCTCTGAGC
  ATCATCTTTCGAAATTTGCAGAAAAGTTTCAGGAATTTAAAGAAGCTGCTCGACTAGCAAAGGAAAAATC
  ACAAGAGAAGATGGAACTTACCAGTACACCTTCACAGGAATCCGCAGGCGGGGATCTTCAGTCTCCTTTA
  ACACCGGAAAGTATCAACGGGACAGATGATGAAAGAACACCTGATGTGACACAGAACTCAGAGCCAAGGG
  CTGAACCAACTCAGAATGCATTGCCATTTTCACATAGGAAGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001277078
• ORF Size: 534 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001277078.1, NP_001264007.1
• RefSeq Size: 3963
• RefSeq ORF: 534
• Locus ID: 9456
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a member of the homer family of dendritic proteins. Members of this family regulate group 1 metabotrophic glutamate receptor function. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3, also known as HOMER1H) lacks three consecutive coding exons compared to variant 1, that causes a frameshift. The resulting isoform (3) has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.