ATP5A (ATP5A1) (NM_001001935) Human Untagged Clone

CAT#: SC331122

ATP5A1 (untagged) - Homo sapiens ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle (ATP5A1), transcript variant 4


  "NM_001001935" in other vectors (2)

Reconstitution Protocol

USD 500.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "ATP5F1A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ATP5F1A
Synonyms ATP5A; ATP5A1; ATP5AL2; ATPM; COXPD22; hATP1; HEL-S-123m; MC5DN4; MOM2; OMR; ORM
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001001935, the custom clone sequence may differ by one or more nucleotides


ATGTCCTCTATTCTTGAAGAGCGTATTCTTGGAGCTGATACCTCTGTTGATCTTGAAGAAACTGGGCGTG
TCTTAAGTATTGGTGATGGTATTGCCCGCGTACATGGGCTGAGGAATGTTCAAGCAGAAGAAATGGTAGA
GTTTTCTTCAGGCTTAAAGGGTATGTCCTTGAACTTGGAACCTGACAATGTTGGTGTTGTCGTGTTTGGA
AATGATAAACTAATTAAGGAAGGAGATATAGTGAAGAGGACAGGAGCCATTGTGGACGTTCCAGTTGGTG
AGGAGCTGTTGGGTCGTGTAGTTGATGCCCTTGGTAATGCTATTGATGGAAAGGGTCCAATTGGTTCCAA
GACGCGTAGGCGAGTTGGTCTGAAAGCCCCCGGTATCATTCCTCGAATTTCAGTGCGGGAACCAATGCAG
ACTGGCATTAAGGCTGTGGATAGCTTGGTGCCAATTGGTCGTGGTCAGCGTGAACTGATTATTGGTGACC
GACAGACTGGGAAAACCTCAATTGCTATTGACACAATCATTAACCAGAAACGTTTCAATGATGGATCTGA
TGAAAAGAAGAAGCTGTACTGTATTTATGTTGCTATTGGTCAAAAGAGATCCACTGTTGCCCAGTTGGTG
AAGAGACTTACAGATGCAGATGCCATGAAGTACACCATTGTGGTGTCGGCTACGGCCTCGGATGCTGCCC
CACTTCAGTACCTGGCTCCTTACTCTGGCTGTTCCATGGGAGAGTATTTTAGAGACAATGGCAAACATGC
TTTGATCATCTATGACGACTTATCCAAACAGGCTGTTGCTTACCGTCAGATGTCTCTGTTGCTCCGCCGA
CCCCCTGGTCGTGAGGCCTATCCTGGTGATGTGTTCTACCTACACTCCCGGTTGCTGGAGAGAGCAGCCA
AAATGAACGATGCTTTTGGTGGTGGCTCCTTGACTGCTTTGCCAGTCATAGAAACACAGGCTGGTGATGT
GTCTGCTTACATTCCAACAAATGTCATTTCCATCACTGACGGACAGATCTTCTTGGAAACAGAATTGTTC
TACAAAGGTATCCGCCCTGCAATTAACGTTGGTCTGTCTGTATCTCGTGTCGGATCCGCTGCCCAAACCA
GGGCTATGAAGCAGGTAGCAGGTACCATGAAGCTGGAATTGGCTCAGTATCGTGAGGTTGCTGCTTTTGC
CCAGTTCGGTTCTGACCTCGATGCTGCCACTCAACAACTTTTGAGTCGTGGCGTGCGTCTAACTGAGTTG
CTGAAGCAAGGACAGTATTCTCCCATGGCTATTGAAGAACAAGTGGCTGTTATCTATGCGGGTGTAAGGG
GATATCTTGATAAACTGGAGCCCAGCAAGATTACAAAGTTTGAGAATGCTTTCTTGTCTCATGTCGTCAG
CCAGCACCAAGCCTTGTTGGGCACTATCAGGGCTGATGGAAAGATCTCAGAACAATCAGATGCAAAGCTG
AAAGAGATTGTAACAAATTTCTTGGCTGGATTTGAAGCTTAA


Restriction Sites SgfI-RsrII     
ACCN NM_001001935
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001001935.2, NP_001001935.1
RefSeq Size 2000 bp
RefSeq ORF 1512 bp
Locus ID 498
Cytogenetics 18q21.1
Protein Families Druggable Genome
Protein Pathways Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
Gene Summary 'This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, using an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the alpha subunit of the catalytic core. Alternatively spliced transcript variants encoding the different isoforms have been identified. Pseudogenes of this gene are located on chromosomes 9, 2, and 16. [provided by RefSeq, Mar 2012]'
Transcript Variant: This variant (4) differs in the 5' UTR and uses an alternate splice junction at the 3' end of an exon compared to variant 1, that causes a frameshift. The resulting isoform (c) is shorter at the N-terminus compared to isoform a. Variants 4 and 5 both encode the same isoform (c).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.