Claudin 15 (CLDN15) (NM_001185080) Human Untagged Clone

CAT#: SC331133

CLDN15 (untagged) - Homo sapiens claudin 15 (CLDN15), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CLDN15
• Synonyms: FLJ42715; MGC19536
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001185080, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCGATGGCTGTGGAAACCTTTGGCTTCTTCATGGCAACTGTGGGGCTGCTGATGCTGGGGGTGACTC
  TGCCAAACAGCTACTGGCGAGTGTCCACTGTGCACGGGAACGTCATCACCACCAACACCATCTTCGAGAA
  CCTCTGGTTTAGCTGTGCCACCGACTCCCTGGGCGTCTACAACTGCTGGGAGTTCCCGTCCATGCTGGCC
  CTCTCTGGGTATATTCAGGCCTGCCGGGCACTCATGATCACCGCCATCCTCCTGGGCTTCCTCGGCCTCT
  TGCTAGGCATAGCGGGCCTGCGCTGCACCAACATTGGGGGCCTGGAGCTCTCCAGGAAAGCCAAGCTGGC
  GGCCACCGCAGGGGCCCTCCACATTCTGGCCGGTATCTGCGGGATGGTGGCCATCTCCTGGTACGCCTTC
  AACATCACCCGGGACTTCTTCGACCCCTTGTACCCCGGAACCAAGTACGAGCTGGGCCCCGCCCTCTACC
  TGGGGTGGAGCGCCTCACTGATCTCCATCCTGGGTGGCCTCTGCCTCTGCTCCGCCTGCTGCTGCGGCTC
  TGACGAGGACCCAGCCGCCAGCGCCCGGCGGCCCTACCAGGCTCCAGTGTCCGTGATGCCCGTCGCCACC
  TCGGACCAAGAAGGCGACAGCAGCTTTGGCAAATACGGCAGAAACGCCTACGTGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001185080
• ORF Size: 687 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001185080.1, NP_001172009.1
• RefSeq Size: 2145
• RefSeq ORF: 687
• Locus ID: 24146
• Protein Families: Transmembrane
• Protein Pathways: Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction
• Gene Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2010]
  Transcript Variant: This variant (1) is the longer transcript. Variants 1 and 2 encode the same protein.