Resistin (RETN) (NM_001193374) Human Untagged Clone
CAT#: SC331163
RETN (untagged) - Homo sapiens resistin (RETN), transcript variant 2
"NM_001193374" in other vectors (2)
Product Images
Other products for "RETN"
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | RETN |
| Synonyms | ADSF; FIZZ3; RETN1; RSTN; XCP1 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001193374, the custom clone sequence may differ by one or more nucleotides
ATGAAAGCTCTCTGTCTCCTCCTCCTCCCTGTCCTGGGGCTGTTGGTGTCTAGCAAGACCCTGTGCTCCA TGGAAGAAGCCATCAATGAGAGGATCCAGGAGGTCGCCGGCTCCCTAATATTTAGGGCAATAAGCAGCAT TGGCCTGGAGTGCCAGAGCGTCACCTCCAGGGGGGACCTGGCTACTTGCCCCCGAGGCTTCGCCGTCACC GGCTGCACTTGTGGCTCCGCCTGTGGCTCGTGGGATGTGCGCGCCGAGACCACATGTCACTGCCAGTGCG CGGGCATGGACTGGACCGGAGCGCGCTGCTGTCGTGTGCAGCCCTGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001193374 |
| ORF Size | 327 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Reference Data | |
| RefSeq | NM_001193374.1, NP_001180303.1 |
| RefSeq Size | 469 |
| RefSeq ORF | 327 |
| Locus ID | 56729 |
| Protein Families | Druggable Genome, Secreted Protein |
| Gene Summary | This gene belongs to the family defined by the mouse resistin-like genes. The characteristic feature of this family is the C-terminal stretch of 10 cys residues with identical spacing. The mouse homolog of this protein is secreted by adipocytes, and may be the hormone potentially linking obesity to type II diabetes. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2010] Transcript Variant: This variant (2) lacks a segment in the 5' UTR, as compared to variant 1. Variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Germany
Japan
United Kingdom
China