Resistin (RETN) (NM_001193374) Human Untagged Clone

CAT#: SC331163

RETN (untagged) - Homo sapiens resistin (RETN), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RETN
• Synonyms: ADSF; FIZZ3; RETN1; RSTN; XCP1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001193374, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAAGCTCTCTGTCTCCTCCTCCTCCCTGTCCTGGGGCTGTTGGTGTCTAGCAAGACCCTGTGCTCCA
  TGGAAGAAGCCATCAATGAGAGGATCCAGGAGGTCGCCGGCTCCCTAATATTTAGGGCAATAAGCAGCAT
  TGGCCTGGAGTGCCAGAGCGTCACCTCCAGGGGGGACCTGGCTACTTGCCCCCGAGGCTTCGCCGTCACC
  GGCTGCACTTGTGGCTCCGCCTGTGGCTCGTGGGATGTGCGCGCCGAGACCACATGTCACTGCCAGTGCG
  CGGGCATGGACTGGACCGGAGCGCGCTGCTGTCGTGTGCAGCCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001193374
• ORF Size: 327 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001193374.1, NP_001180303.1
• RefSeq Size: 469
• RefSeq ORF: 327
• Locus ID: 56729
• Protein Families: Druggable Genome, Secreted Protein
• Gene Summary: This gene belongs to the family defined by the mouse resistin-like genes. The characteristic feature of this family is the C-terminal stretch of 10 cys residues with identical spacing. The mouse homolog of this protein is secreted by adipocytes, and may be the hormone potentially linking obesity to type II diabetes. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2010]
  Transcript Variant: This variant (2) lacks a segment in the 5' UTR, as compared to variant 1. Variants 1 and 2 encode the same protein.