CD4 (NM_001195016) Human Untagged Clone

CAT#: SC331173

CD4 (untagged) - Homo sapiens CD4 molecule (CD4), transcript variant 4


  "NM_001195016" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CD4
Synonyms CD4mut
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001195016, the custom clone sequence may differ by one or more nucleotides


ATGGGCAAGAAGCTCCCGCTCCACCTCACCCTGCCCCAGGCCTTGCCTCAGTATGCTGGCTCTGGAAACC
TCACCCTGGCCCTTGAAGCGAAAACAGGAAAGTTGCATCAGGAAGTGAACCTGGTGGTGATGAGAGCCAC
TCAGCTCCAGAAAAATTTGACCTGTGAGGTGTGGGGACCCACCTCCCCTAAGCTGATGCTGAGTTTGAAA
CTGGAGAACAAGGAGGCAAAGGTCTCGAAGCGGGAGAAGGCGGTGTGGGTGCTGAACCCTGAGGCGGGGA
TGTGGCAGTGTCTGCTGAGTGACTCGGGACAGGTCCTGCTGGAATCCAACATCAAGGTTCTGCCCACATG
GTCCACCCCGGTGCAGCCAATGGCCCTGATTGTGCTGGGGGGCGTCGCCGGCCTCCTGCTTTTCATTGGG
CTAGGCATCTTCTTCTGTGTCAGGTGCCGGCACCGAAGGCGCCAAGCAGAGCGGATGTCTCAGATCAAGA
GACTCCTCAGTGAGAAGAAGACCTGCCAGTGTCCTCACCGGTTTCAGAAGACATGTAGCCCCATTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001195016
ORF Size 558 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001195016.2, NP_001181945.1
RefSeq Size 2853
RefSeq ORF 558
Locus ID 920
Protein Families Adult stem cells, Druggable Genome, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Transmembrane
Protein Pathways Antigen processing and presentation, Cell adhesion molecules (CAMs), Hematopoietic cell lineage, Primary immunodeficiency, T cell receptor signaling pathway
Gene Summary This gene encodes a membrane glycoprotein of T lymphocytes that interacts with major histocompatibility complex class II antigenes and is also a receptor for the human immunodeficiency virus. This gene is expressed not only in T lymphocytes, but also in B cells, macrophages, and granulocytes. It is also expressed in specific regions of the brain. The protein functions to initiate or augment the early phase of T-cell activation, and may function as an important mediator of indirect neuronal damage in infectious and immune-mediated diseases of the central nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Aug 2010]
Transcript Variant: This variant (4) lacks two consecutive exons and initiates translation from a downstream, in-frame start codon, compared to variant 1. Variants 3, 4 and 5 encode isoform 3, which has a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.