SC35 (SRSF2) (NM_001195427) Human Untagged Clone

CAT#: SC331186

SRSF2 (untagged) - Homo sapiens serine/arginine-rich splicing factor 2 (SRSF2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SRSF2
• Synonyms: PR264; SC-35; SC35; SFRS2; SFRS2A; SRp30b
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001195427, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGCTACGGCCGCCCCCCTCCCGATGTGGAGGGTATGACCTCCCTCAAGGTGGACAACCTGACCTACC
  GCACCTCGCCCGACACGCTGAGGCGCGTCTTCGAGAAGTACGGGCGCGTCGGCGACGTGTACATCCCGCG
  GGACCGCTACACCAAGGAGTCCCGCGGCTTCGCCTTCGTTCGCTTTCACGACAAGCGCGACGCTGAGGAC
  GCTATGGATGCCATGGACGGGGCCGTGCTGGACGGCCGCGAGCTGCGGGTGCAAATGGCGCGCTACGGCC
  GCCCCCCGGACTCACACCACAGCCGCCGGGGACCGCCACCCCGCAGGTACGGGGGCGGTGGCTACGGACG
  CCGGAGCCGCAGCCCTAGGCGGCGTCGCCGCAGCCGATCCCGGAGTCGGAGCCGTTCCAGGTCTCGCAGC
  CGATCTCGCTACAGCCGCTCGAAGTCTCGGTCCCGCACTCGTTCTCGATCTCGGTCGACCTCCAAGTCCA
  GATCCGCACGAAGGTCCAAGTCCAAGTCCTCGTCGGTCTCCAGATCTCGTTCGCGGTCCAGGTCCCGGTC
  TCGGTCCAGGAGTCCTCCCCCAGTGTCCAAGAGGGAATCCAAATCCAGGTCGCGATCGAAGAGTCCCCCC
  AAGTCTCCTGAAGAGGAAGGAGCGGTGTCCTCTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001195427
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001195427.1, NP_001182356.1
• RefSeq Size: 2008 bp
• RefSeq ORF: 666 bp
• Locus ID: 6427
• Cytogenetics: 17q25.1
• Protein Families: Stem cell - Pluripotency, Transcription Factors
• Protein Pathways: Spliceosome
• Gene Summary: 'The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two transcript variants encoding the same protein and one non-coding transcript variant have been found for this gene. In addition, a pseudogene of this gene has been found on chromosome 11. [provided by RefSeq, Sep 2010]'
  Transcript Variant: This variant (2) differs in the 3' UTR compared to variant 1. Variants 1 and 2 both encode the same protein.