IRF3 (NM_001197128) Human Untagged Clone

CAT#: SC331196

IRF3 (untagged) - Homo sapiens interferon regulatory factor 3 (IRF3), transcript variant 8

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IRF3
• Synonyms: IIAE7
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001197128, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTGTTGGCCCCACTCCCAGATCCGGGACCCCCAAGCCTGGCTGTAGCCCCTGAGCCCTGCCCTCAGC
  CCCTGCGGAGCCCCAGCTTGGACAATCCCACTCCCTTCCCAAACCTGGGGCCCTCTGAGAACCCACTGAA
  GCGGCTGTTGGTGCCGGGGGAAGATCTGATTACCTTCACGGAAGGAAGCGGACGCTCACCACGCTATGCC
  CTCTGGTTCTGTGTGGGGGAGTCATGGCCCCAGGACCAGCCGTGGACCAAGAGGCTCGTGATGGTCAAGG
  TTGTGCCCACGTGCCTCAGGGCCTTGGTAGAAATGGCCCGGGTAGGGGGTGCCTCCTCCCTGGAGAATAC
  TGTGGACCTGCACATTTCCAACAGCCACCCACTCTCCCTCACCTCCGACCAGTACAAGGCCTACCTGCAG
  GACTTGGTGGAGGGCATGGATTTCCAGGGCCCTGGGGAGAGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001197128
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001197128.1, NP_001184057.1
• RefSeq Size: 900 bp
• RefSeq ORF: 465 bp
• Locus ID: 3661
• Cytogenetics: 19q13.33
• Protein Families: Druggable Genome, Transcription Factors
• Protein Pathways: Cytosolic DNA-sensing pathway, RIG-I-like receptor signaling pathway, Toll-like receptor signaling pathway
• Gene Summary: 'This gene encodes a member of the interferon regulatory transcription factor (IRF) family. The encoded protein is found in an inactive cytoplasmic form that upon serine/threonine phosphorylation forms a complex with CREBBP. This complex translocates to the nucleus and activates the transcription of interferons alpha and beta, as well as other interferon-induced genes. The protein plays an important role in the innate immune response against DNA and RNA viruses. Mutations in this gene are associated with Encephalopathy, acute, infection-induced, herpes-specific, 7. [provided by RefSeq, Sep 2020]'
  Transcript Variant: This variant (8, also known as IRF3b) lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. This variant also lacks an in-frame exon compared to variant 1. The encoded isoform (6) is shorter than isoform 1. Both variants 7 and 8 encode the same isoform (6).