ASCC1 (NM_001198798) Human Untagged Clone

CAT#: SC331222

ASCC1 (untagged) - Homo sapiens activating signal cointegrator 1 complex subunit 1 (ASCC1), transcript variant 4


  "NM_001198798" in other vectors (2)

Reconstitution Protocol

USD 360.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "ASCC1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ASCC1
Synonyms ASC1p50; CGI-18; p50; SMABF2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001198798, the custom clone sequence may differ by one or more nucleotides


ATGGAAGTTCTGCGTCCACAGCTTATAAGAATTGATGGCCGGAATTACAGGAAGAATCCAGTCCAAGAAC
AGACCTATCAACATGAAGAAGATGAAGAGGACTTCTATCAAGGCTCCATGGAGTGTGCTGATGAGCCCTG
TGATGCCTACGAGGTGGAGCAGACCCCACAAGGATTCCGGTCTACTTTGAGGGCCCCCAGCTTGCTCTAT
AAGCATATAGTTGGAAAGAGAGGGGACACTAGGAAGAAAATAGAAATGGAGACCAAAACTTCTATTAGCA
TTCCTAAACCTGGACAAGACGGGGAAATTGTAATCACTGGCCAGCATCGAAATGGTGTAATTTCAGCCCG
AACACGGATTGATGTTCTTTTGGACACTTTTCGAAGAAAGCAGCCCTTCACTCACTTCCTTGCCTTTTTC
CTCAATGAAGTTGAGGTTCAGGAAGGATTCCTGAGATTCCAGGAGGAAGTACTGGCGAAGTGCTCCATGG
ATCATGGGGTTGACAGCAGCATTTTCCAGAATCCTAAAAAGCTTCATCTAACTATTGGGATGTTGGTGCT
TTTGAGTGAGGAAGAGATCCAGCAGACATGTGAGATGCTACAGCAGTGTAAAGAGGAATTCATTAATGAT
ATTTCTGGGGGTAAACCCCTAGAAGTGGAGATGGCAGGGATAGAATACATGAATGATGATCCTGGCATGG
TGGATGTTCTTTACGCCAAAGTCCATATGAAAGATGGCTCCAACAGGCTACAAGAATTAGTTGATCGAGT
GCTGGAACGTTTTCAGGCATCTGGACTAATAGTGAAAGAGTGGAATAGTGTGAAACTGCATGCTACAGTT
ATGAATACACTATTCAGGAAAGACCCCAATGCTGAAGGCAGGTACAATCTCTACACAGCGGAAGGCAAAT
ATATCTTCAAGGAAAGAGAATCATTTGATGGCCGAAATATTTTAAAGTTGTTTGAGAACTTCTACTTTGG
CTCCCTAAAGCTGAATTCAATTCACATCTCTCAGAGGTTCACCGTAGACAGCTTTGGAAACTACGCTTCC
TGTGGACAAATTGACTTCTCCTGA


Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_001198798
ORF Size 1074 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001198798.2, NP_001185727.1
RefSeq Size 2683
RefSeq ORF 1074
Locus ID 51008
Gene Summary This gene encodes a subunit of the activating signal cointegrator 1 (ASC-1) complex. The ASC-1 complex is a transcriptional coactivator that plays an important role in gene transactivation by multiple transcription factors including activating protein 1 (AP-1), nuclear factor kappa-B (NF-kB) and serum response factor (SRF). The encoded protein contains an N-terminal KH-type RNA-binding motif which is required for AP-1 transactivation by the ASC-1 complex. Mutations in this gene are associated with Barrett esophagus and esophageal adenocarcinoma. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (4) differs in the 5' UTR and lacks three exons in the coding region, which results in a translational frameshift, compared to variant 1. Variants 2 and 4 encode the same isoform (b) which is shorter and has a distinct C-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.