CMTM2 (NM_001199317) Human Untagged Clone

CAT#: SC331296

CMTM2 (untagged) - Homo sapiens CKLF-like MARVEL transmembrane domain containing 2 (CMTM2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CMTM2
• Synonyms: CKLFSF2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199317, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCACCTAAGGCGGCAAAGGGGGCCAAGCCAGAGCCAGCACCAGCTCCACCTCCACCCGGGGCCAAAC
  CCGAGGAAGACAAGAAGGACGGTAAGGAGCCATCGGACAAACCTCAAAAGGCGGTGCAGGACCATAAGGA
  GCCATCGGACAAACCTCAAAAGGCGGTGCAGCCCAAGCACGAAGTGGGCACGAGGAGGGGGTGTCGCCGC
  TACCGGTGGGAATTAAAAGACAGCAATAAAGAGTTCTGGCTCTTGGGGCACGCTGAGATCAAGATTCGGA
  GTTTGGACCTCTTCAACGACCTGATTGCTTGTGCGTTCCTTGTGGGAGCCGTGGTCTTTGCTGTGAGAAG
  TCGGCGATCCATGAATCTCCACTACTTACTTGCTGTGATCCTTATTGGTGCGGCTGGAGTTTTTGCTTTT
  ATCGATGTGTGTCTTCAAAGAAACCACTTCAGAGGCAAGAAGGCCAAAAAGCATATGCTGGTTCCTCCTC
  CAGGAAAGGAAAAAGGACCCCAGCAGGGCAAGGGACCAGAACCCGCCAAGCCACCAGAACCTGGCAAGCC
  ACCAGGGCCAGCAAAGGGAAAGAAATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199317
• ORF Size: 588 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001199317.1, NP_001186246.1
• RefSeq Size: 914
• RefSeq ORF: 588
• Locus ID: 146225
• Protein Families: Transmembrane
• Gene Summary: This gene belongs to the chemokine-like factor gene superfamily, a novel family that links the chemokine and the transmembrane 4 superfamilies of signaling molecules. The protein encoded by this gene may play an important role in testicular development. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) lacks an in-frame exon in the coding region, compared to variant 1. The resulting protein (isoform 2) is shorter, compared to isoform 1.