HOXD8 (NM_001199746) Human Untagged Clone

CAT#: SC331352

HOXD8 (untagged) - Homo sapiens homeobox D8 (HOXD8), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HOXD8
• Synonyms: HOX4; HOX4E; HOX5.4
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199746, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGTTCGTACTTCGTGAACCCGCTGTACTCCAAGTACAAGGCGGCGGCTGCGGCGGCGGCGGCGGCGG
  GCGAGGCCATCAATCCCACTTACTACGACTGTCACTTCGCGCCCGAGGTCGGCGGCCGTCACGCCGCCGC
  CGCAGCAGCCCTGCAGCTCTATGGCAACAGCGCCGCCGGCTTCCCGCACGCGCCCCCGCAGGCGCACGCG
  CACCCGCACCCGTCCCCGCCGCCCTCCGGGACTGGGTGCGGCGGTAGGGAAGGCCGGGGCCAGGAGTACT
  TCCACCCCGGCGGGGGCAGCCCGGCCGCTGCCTACCAGGCCGCCCCCCCTCCTCCTCCGCATCCTCCGCC
  TCCGCCGCCACCTCCCCCCTGCGGCGGGATTGCCTGTCACGGGGAGCCCGCGAAGTTTTACGGATACGAT
  AACTTACAGAGACAGCCGATTTTTACGACCCAGCAAGAGGCCGAGCTGGTACAATATCCTGACTGTAAAT
  CGTCCAGTGGTAATATTGGCGAGGACCCAGACCACTTAAATCAGAGCTCGTCTCCTTCTCAAATGTTTCC
  GTGGATGAGACCACAAGCTCCTGGTAGACGAAGAGGAAGACAAACCTACAGTCGCTTCCAAACTCTAGAG
  TTGGAAAAGGAATTTCTTTTTAACCCCTATCTGACCAGGAAAAGAAGAATCGAGGTTTCCCACGCCCTAG
  CCCTCACCGAGAGACAGGTAAAAATCTGGTTCCAGAACAGGAGAATGAAATGGAAAAAGGAAAACAACAA
  GGACAAATTTCCCGTTTCCCGGCAGGAGGTGAAGGACGGGGAAACGAAAAAGGAAGCCCAAGAGCTGGAG
  GAAGACAGAGCCGAAGGCCTGACAAATTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199746
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001199746.1, NP_001186675.1
• RefSeq Size: 2596 bp
• RefSeq ORF: 870 bp
• Locus ID: 3234
• Cytogenetics: 2q31.1
• Protein Families: ES Cell Differentiation/IPS, Transcription Factors
• Gene Summary: 'This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. In addition to effects during embryogenesis, this particular gene may also play a role in adult urogenital tract function. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Dec 2010]'
  Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.