BCL2L2 (NM_001199839) Human Untagged Clone

CAT#: SC331379

BCL2L2 (untagged) - Homo sapiens BCL2-like 2 (BCL2L2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BCL2L2
• Synonyms: BCL-W; BCL2-L-2; BCLW; PPP1R51
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199839, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGACCCCAGCCTCGGCCCCAGACACACGGGCTCTGGTGGCAGACTTTGTAGGTTATAAGCTGAGGC
  AGAAGGGTTATGTCTGTGGAGCTGGCCCCGGGGAGGGCCCAGCAGCTGACCCGCTGCACCAAGCCATGCG
  GGCAGCTGGAGATGAGTTCGAGACCCGCTTCCGGCGCACCTTCTCTGATCTGGCGGCTCAGCTGCATGTG
  ACCCCAGGCTCAGCCCAACAACGCTTCACCCAGGTCTCCGATGAACTTTTTCAAGGGGGCCCCAACTGGG
  GCCGCCTTGTAGCCTTCTTTGTCTTTGGGGCTGCACTGTGTGCTGAGAGTGTCAACAAGGAGATGGAACC
  ACTGGTGGGACAAGTGCAGGAGTGGATGGTGGCCTACCTGGAGACGCGGCTGGCTGACTGGATCCACAGC
  AGTGGGGGCTGGGCGGAGTTCACAGCTCTATACGGGGACGGGGCCCTGGAGGAGGCGCGGCGTCTGCGGG
  AGGGGAACTGGGCATCAGTGAGGACAGTGCTGACGGGGGCCGTGGCACTGGGGGCCCTGGTAACTGTAGG
  GGCCTTTTTTGCTAGCAAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199839
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001199839.1, NP_001186768.1
• RefSeq Size: 3576 bp
• RefSeq ORF: 582 bp
• Locus ID: 599
• Cytogenetics: 14q11.2
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: 'This gene encodes a member of the BCL-2 protein family. The proteins of this family form hetero- or homodimers and act as anti- and pro-apoptotic regulators. Expression of this gene in cells has been shown to contribute to reduced cell apoptosis under cytotoxic conditions. Studies of the related gene in mice indicated a role in the survival of NGF- and BDNF-dependent neurons. Mutation and knockout studies of the mouse gene demonstrated an essential role in adult spermatogenesis. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream PABPN1 (poly(A) binding protein, nuclear 1) gene. [provided by RefSeq, Dec 2010]'
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.