Angiopoietin 1 (ANGPT1) (NM_001199859) Human Untagged Clone

CAT#: SC331381

ANGPT1 (untagged) - Homo sapiens angiopoietin 1 (ANGPT1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ANGPT1
• Synonyms: AGP1; AGPT; ANG1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199859, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACAGTTTTCCTTTCCTTTGCTTTCCTCGCTGCCATTCTGACTCACATAGGGTGCAGCAATCAGCGCC
  GAAGTCCAGAAAACAGTGGGAGAAGATATAACCGGATTCAACATGGGCAATGTGCCTACACTTTCATTCT
  TCCAGAACACGATGGCAACTGTCGTGAGAGTACGACAGACCAGTACAACACAAACGCTCTGCAGAGAGAT
  GCTCCACACGTGGAACCGGATTTCTCTTCCCAGAAACTTCAACATCTGGAACATGTGATGGAAAATTATA
  CTCAGTGGCTGCAAAAACTTGAGAATTACATTGTGGAAAACATGAAGTCGGAGATGGCCCAGATACAGCA
  GAATGCAGTTCAGAACCACACGGCTACCATGCTGGAGATAGGAACCAGCCTCCTCTCTCAGACTGCAGAG
  CAGACCAGAAAGCTGACAGATGTTGAGACCCAGGTACTAAATCAAACTTCTCGACTTGAGATACAGCTGC
  TGGAGAATTCATTATCCACCTACAAGCTAGAGAAGCAACTTCTTCAACAGACAAATGAAATCTTGAAGAT
  CCATGAAAAAAACAGTTTATTAGAACATAAAATCTTAGAAATGGAAGGAAAACACAAGGAAGAGTTGGAC
  ACCTTAAAGGAAGAGAAAGAGAACCTTCAAGGCTTGGTTACTCGTCAAACATATATAATCCAGGAGCTGG
  AAAAGCAATTAAACAGAGCTACCACCAACAACAGTGTCCTTCAGAAGCAGCAACTGGAGCTGATGGACAC
  AGTCCACAACCTTGTCAATCTTTGCACTAAAGAAGTTTTACTAAAGGGAGGAAAAAGAGAGGAAGAGAAA
  CCATTTAGAGACTGTGCAGATGTATATCAAGCTGGTTTTAATAAAAGTGGAATCTACACTATTTATATTA
  ATAATATGCCAGAACCCAAAAAGGTGTTTTGCAATATGGATGTCAATGGGGGAGGTTGGACTGTAATACA
  ACATCGTGAAGATGGAAGTCTAGATTTCCAAAGAGGCTGGAAGGAATATAAAATGGGTTTTGGAAATCCC
  TCCGGTGAATATTGGCTGGGGAATGAGTTTATTTTTGCCATTACCAGTCAGAGGCAGTACATGCTAAGAA
  TTGAGTTAATGGACTGGGAAGGGAACCGAGCCTATTCACAGTATGACAGATTCCACATAGGAAATGAAAA
  GCAAAACTATAGGTTGTATTTAAAAGGTCACACTGGGACAGCAGGAAAACAGAGCAGCCTGATCTTACAC
  GGTGCTGATTTCAGCACTAAAGATGCTGATAATGACAACTGTATGTGCAAATGTGCCCTCATGTTAACAG
  GAGGATGGTGGTTTGATGCTTGTGGCCCCTCCAATCTAAATGGAATGTTCTATACTGCGGGACAAAACCA
  TGGAAAACTGAATGGGATAAAGTGGCACTACTTCAAAGGGCCCAGTTACTCCTTACGTTCCACAACTATG
  ATGATTCGACCTTTAGATTTTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199859
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001199859.1, NP_001186788.1
• RefSeq Size: 4335 bp
• RefSeq ORF: 1494 bp
• Locus ID: 284
• Cytogenetics: 8q23.1
• Protein Families: Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein
• Gene Summary: 'This gene encodes a secreted glycoprotein that belongs to the angiopoietin family. Members of this family play important roles in vascular development and angiogenesis. All angiopoietins bind with similar affinity to an endothelial cell-specific tyrosine-protein kinase receptor. The protein encoded by this gene is a secreted glycoprotein that activates the receptor by inducing its tyrosine phosphorylation. It plays a critical role in mediating reciprocal interactions between the endothelium and surrounding matrix and mesenchyme and inhibits endothelial permeability. The protein also contributes to blood vessel maturation and stability, and may be involved in early development of the heart. Mutations in this gene are associated with hereditary angioedema. [provided by RefSeq, Aug 2020]'
  Transcript Variant: This variant (2) uses an alternate in-frame splice site in the coding region, compared to variant 1, which results in an isoform (2) that is one amino acid shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.