EGR3 (NM_001199881) Human Untagged Clone

CAT#: SC331389

EGR3 (untagged) - Homo sapiens early growth response 3 (EGR3), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: EGR3
• Synonyms: EGR-3; PILOT
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199881, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGACATCGGTCTGACCAACGAGAAGCCCAACCCGGAACTCTCTTACTCCGGCTCCTTCCAGCCAGCCC
  CCGGCAACAAGACCGTGACCTACTTGGGAAAGTTCGCCTTCGACTCCCCTTCCAACTGGTGCCAGGACAA
  CATCATTAGCCTCATGAGCGCCGGCATCTTGGGGGTGCCCCCGGCTTCAGGGGCGCTCAGCACGCAGACG
  TCCACGGCCAGCATGGTGCAGCCACCGCAGGGTGACGTGGAGGCCATGTATCCCGCGCTACCCCCCTACT
  CCAACTGCGGCGACCTCTACTCAGAGCCCGTGTCTTTCCACGACCCCCAGGGCAATCCCGGGCTCGCCTA
  TTCCCCCCAGGATTACCAATCGGCCAAGCCGGCGTTGGACAGCAATCTCTTCCCCATGATTCCTGACTAC
  AACCTCTACCACCACCCCAACGACATGGGCTCCATTCCGGAGCACAAGCCCTTCCAGGGCATGGACCCCA
  TCCGGGTCAACCCGCCCCCTATTACCCCTCTGGAGACCATCAAGGCATTCAAAGACAAGCAGATCCACCC
  GGGCTTTGGCAGCCTGCCCCAGCCGCCGCTCACCCTCAAGCCCATCCGGCCCCGCAAGTACCCCAACCGG
  CCTAGCAAGACACCGCTCCACGAACGGCCCCACGCGTGCCCGGCCGAGGGCTGCGACCGCCGTTTCAGCC
  GTTCGGACGAGCTGACCCGGCACCTGCGCATCCACACGGGCCACAAGCCCTTCCAGTGCCGGATCTGCAT
  GCGGAGCTTCAGCCGCAGCGACCACCTCACCACTCACATCCGCACTCATACGGGCGAGAAGCCCTTTGCC
  TGCGAGTTCTGCGGGCGCAAGTTTGCGCGCAGCGACGAGCGCAAGCGCCACGCCAAGATCCACCTCAAGC
  AAAAGGAGAAGAAGGCGGAGAAGGGCGGTGCACCCTCTGCATCCTCGGCGCCCCCCGTGTCGCTGGCCCC
  CGTGGTCACCACCTGCGCCTGA
  
  
• Restriction Sites: SgfI-RsrII
• ACCN: NM_001199881
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001199881.1, NP_001186810.1
• RefSeq Size: 3912 bp
• RefSeq ORF: 1002 bp
• Locus ID: 1960
• Cytogenetics: 8p21.3
• Gene Summary: 'This gene encodes a transcriptional regulator that belongs to the EGR family of C2H2-type zinc-finger proteins. It is an immediate-early growth response gene which is induced by mitogenic stimulation. The protein encoded by this gene participates in the transcriptional regulation of genes in controling biological rhythm. It may also play a role in a wide variety of processes including muscle development, lymphocyte development, endothelial cell growth and migration, and neuronal development. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Dec 2010]'
  Transcript Variant: This variant (3) initiates from a distinct promoter and has a different 5' end, compared to variant (1). It encodes an isoform (3) with a shorter N-terminus, compared to isoform 1.