ACTG2 (NM_001199893) Human Untagged Clone
CAT#: SC331390
ACTG2 (untagged) - Homo sapiens actin, gamma 2, smooth muscle, enteric (ACTG2), transcript variant 2
"NM_001199893" in other vectors (2)
Product Images
Other products for "ACTG2"
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | ACTG2 |
| Synonyms | ACT; ACTA3; ACTE; ACTL3; ACTSG; VSCM |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001199893, the custom clone sequence may differ by one or more nucleotides
ATGTGTGAAGAGGAGACCACCGCGCTCGTGTGTGACAATGGCTCTGGCCTGTGCAAGGCAGGCTTCGCAG GAGATGATGCCCCCCGGGCTGTCTTCCCCTCCATTGTGGGCCGCCCTCGCCACCAGATCTGGCACCACTC CTTCTACAATGAGCTGCGTGTAGCACCTGAAGAGCACCCCACCCTGCTCACAGAGGCTCCCCTAAATCCC AAGGCCAACAGGGAAAAGATGACCCAGATCATGTTTGAAACCTTCAATGTCCCTGCCATGTACGTCGCCA TTCAAGCTGTGCTCTCCCTCTATGCCTCTGGCCGCACGACAGGCATCGTCCTGGATTCAGGTGATGGCGT CACCCACAATGTCCCCATCTATGAAGGCTATGCCCTGCCCCATGCCATCATGCGCCTGGACTTGGCTGGC CGTGACCTCACGGACTACCTCATGAAGATCCTCACAGAGAGAGGCTATTCCTTTGTGACCACAGCTGAGA GAGAAATTGTGCGAGACATCAAGGAGAAGCTGTGCTATGTGGCCCTGGATTTTGAGAATGAGATGGCCAC AGCAGCTTCCTCTTCCTCCCTGGAGAAGAGCTATGAGCTGCCAGATGGGCAGGTTATCACCATTGGCAAT GAGCGCTTCCGCTGCCCTGAGACCCTCTTCCAGCCTTCCTTTATTGGCATGGAGTCCGCTGGAATTCATG AGACAACCTACAATTCCATCATGAAGTGTGACATTGACATCCGTAAGGACTTATATGCCAACAATGTCCT CTCTGGGGGCACCACCATGTACCCTGGCATTGCTGACAGGATGCAGAAGGAGATCACAGCCCTGGCCCCC AGCACCATGAAGATCAAGATTATTGCTCCCCCAGAGCGGAAGTACTCAGTCTGGATCGGGGGCTCTATCC TGGCCTCTCTCTCCACCTTCCAGCAGATGTGGATCAGCAAGCCTGAGTATGATGAGGCAGGGCCCTCCAT TGTCCACAGGAAGTGCTTCTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001199893 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001199893.1, NP_001186822.1 |
| RefSeq Size | 1216 bp |
| RefSeq ORF | 1002 bp |
| Locus ID | 72 |
| Cytogenetics | 2p13.1 |
| Protein Pathways | Vascular smooth muscle contraction |
| Gene Summary | 'Actins are highly conserved proteins that are involved in various types of cell motility and in the maintenance of the cytoskeleton. Three types of actins, alpha, beta and gamma, have been identified in vertebrates. Alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. The beta and gamma actins co-exist in most cell types as components of the cytoskeleton and as mediators of internal cell motility. This gene encodes actin gamma 2; a smooth muscle actin found in enteric tissues. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Based on similarity to peptide cleavage of related actins, the mature protein of this gene is formed by removal of two N-terminal peptides.[provided by RefSeq, Dec 2010]' Transcript Variant: This variant (2) lacks an in-frame exon in the 5' coding region, compared to variant 1, that results in a shorter isoform (2), compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Germany
Japan
United Kingdom
China