UQCRB (NM_001199975) Human Untagged Clone
CAT#: SC331394
UQCRB (untagged) - Homo sapiens ubiquinol-cytochrome c reductase binding protein (UQCRB), transcript variant 2
"NM_001199975" in other vectors (2)
Product Images
Other products for "UQCRB"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | UQCRB |
Synonyms | MC3DN3; QCR7; QP-C; QPC; UQBC; UQBP; UQCR6; UQPC |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001199975, the custom clone sequence may differ by one or more nucleotides
ATGCGAGATGATACAATATACGAGGATGAAGATGTAAAAGAAGCCATAAGAAGACTTCCTGAGAACCTTT ATAATGACAGGATGTTTCGCATTAAGAGGGCACTGGACCTGAACTTGAAGCATCAGATCTTGCCTAAAGA GCAGTGGACCAAATATGAAGAGGAAAATTTCTACCTTGAACCGTATCTGAAAGAGGTTATTCGGGAAAGA AAAGAAAGAGAAGAATGGGCAAAGAAGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199975 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001199975.2, NP_001186904.1 |
RefSeq Size | 4953 bp |
RefSeq ORF | 240 bp |
Locus ID | 7381 |
Cytogenetics | 8q22.1 |
Protein Pathways | Alzheimer's disease, Cardiac muscle contraction, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
Gene Summary | 'This gene encodes a subunit of the ubiquinol-cytochrome c oxidoreductase complex, which consists of one mitochondrial-encoded and 10 nuclear-encoded subunits. The protein encoded by this gene binds ubiquinone and participates in the transfer of electrons when ubiquinone is bound. This protein plays an important role in hypoxia-induced angiogenesis through mitochondrial reactive oxygen species-mediated signaling. Mutations in this gene are associated with mitochondrial complex III deficiency. Alternatively spliced transcript variants have been found for this gene. Related pseudogenes have been identified on chromosomes 1, 5 and X. [provided by RefSeq, Dec 2011]' Transcript Variant: This variant (2) has an additional exon in its 5' UTR, which results in the use of a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) is shorter at the N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.