FUS2 (NAT6) (NM_001200016) Human Untagged Clone

CAT#: SC331398

NAT6 (untagged) - Homo sapiens N-acetyltransferase 6 (GCN5-related) (NAT6), transcript variant 2


  "NM_001200016" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "NAT6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NAT6
Synonyms FUS-2; FUS2; HsNAAA80; NAT6
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001200016, the custom clone sequence may differ by one or more nucleotides


ATGGAGCTGATCCTGAGTACCAGCCCAGCTGAGCTGACTCTGGATCCTGCGTGCCAGCCAAAGCTGCCCC
TGGATTCCACATGCCAACCAGAGATGACCTTCAATCCTGGTCCAACTGAGCTTACCCTGGATCCTGAACA
CCAGCCAGAGGAGACCCCAGCTCCTAGCCTGGCTGAGTTGACCCTGGAGCCTGTGCACCGCCGACCCGAG
CTCCTGGATGCTTGTGCTGACCTCATCAATGATCAGTGGCCCCGCAGCCGCACCTCCCGCCTGCACTCCC
TGGGCCAGTCCTCAGATGCCTTCCCCCTCTGCCTGATGCTGCTAAGCCCCCACCCCACACTTGAAGCAGC
ACCCGTTGTGGTGGGCCATGCCCGCCTGTCACGGGTGCTGAACCAGCCCCAGAGCCTCTTAGTGGAGACA
GTGGTGGTGGCCCGGGCCCTGAGGGGCCGTGGCTTTGGCCGCCGCCTCATGGAGGGCCTGGAGGTCTTTG
CTCGGGCCCGGGGCTTCCGCAAGCTGCATCTCACCACCCATGACCAGGTGCACTTCTATACCCACCTGGG
CTACCAGCTGGGTGAGCCTGTGCAGGGCCTGGTCTTCACCAGCAGACGGCTGCCTGCCACCCTGCTTAAT
GCCTTCCCCACAGCCCCCTCTCCCCGGCCACCCAGGAAGGCCCCAAACCTGACTGCCCAAGCTGCCCCAA
GGGGTCCCAAGGGACCTCCATTGCCACCACCCCCTCCCCTACCTGAGTGCCTGACCATCTCACCCCCAGT
TCCATCAGGGCCCCCTTCAAAAAGCCTGCTGGAGACACAATATCAAAATGTGAGGGGGCGCCCCATATTC
TGGATGGAAAAAGACATCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001200016
ORF Size 861 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001200016.1, NP_001186945.1
RefSeq Size 1497
RefSeq ORF 861
Locus ID 24142
Protein Pathways Glycerophospholipid metabolism, Limonene and pinene degradation, Phenylalanine metabolism, Tyrosine metabolism
Gene Summary This gene encodes a member of the N-acetyltransferase family. N-acetyltransferases modify proteins by transferring acetyl groups from acetyl CoA to the N-termini of protein substrates. The encoded protein is a cytoplasmic N-acetyltransferase with a substrate specificity for proteins with an N-terminal methionine. This gene is located in the tumor suppressor gene region on chromosome 3p21.3 and the encoded protein may play a role in cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed. This gene overlaps and is on the same strand as hyaluronoglucosaminidase 3, and some transcripts of each gene share a portion of the first exon. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (2) contains an alternate splice site in the 5' UTR and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.