PPP1R3B (NM_001201329) Human Untagged Clone

CAT#: SC331407

PPP1R3B (untagged) - Homo sapiens protein phosphatase 1, regulatory subunit 3B (PPP1R3B), transcript variant 1


  "NM_001201329" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PPP1R3B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PPP1R3B
Synonyms GL; PPP1R4; PTG
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001201329, the custom clone sequence may differ by one or more nucleotides


ATGATGGCTGTGGACATCGAGTACAGATACAACTGCATGGCTCCTTCCTTGCGCCAAGAGAGGTTTGCCT
TTAAGATCTCACCAAAGCCCAGCAAACCACTGAGGCCTTGTATTCAGCTGAGCAGCAAGAATGAAGCCAG
TGGAATGGTGGCCCCGGCTGTCCAGGAGAAGAAGGTGAAAAAGCGGGTGTCCTTCGCAGACAACCAGGGG
CTGGCCCTGACAATGGTCAAAGTGTTCTCGGAATTCGATGACCCGCTAGATATGCCATTCAACATCACCG
AGCTCCTAGACAACATTGTGAGCTTGACGACAGCAGAGAGCGAGAGCTTTGTTCTGGATTTTTCCCAGCC
CTCTGCAGATTACTTAGACTTTAGAAATCGACTTCAGGCCGACCACGTCTGCCTTGAGAACTGTGTGCTC
AAGGACAAGGCCATTGCAGGCACTGTGAAGGTTCAGAACCTCGCATTTGAGAAGACCGTGAAAATAAGGA
TGACGTTCGACACCTGGAAGAGCTACACAGACTTTCCTTGTCAGTACGTGAAGGACACTTATGCCGGTTC
AGACAGGGACACGTTCTCCTTCGACATCAGCTTGCCCGAGAAGATTCAGTCTTATGAAAGAATGGAGTTT
GCTGTGTACTACGAGTGCAATGGACAGACGTACTGGGACAGCAACAGAGGCAAGAACTATAGGATCATCC
GGGCTGAGTTAAAATCTACCCAGGGAATGACCAAGCCCCACAGTGGACCGGATTTGGGAATATCCTTTGA
CCAGTTCGGAAGCCCTCGGTGTTCCTATGGTCTGTTTCCAGAGTGGCCAAGTTACTTAGGATATGAAAAG
CTAGGGCCCTACTACTAG


Restriction Sites SgfI-MluI     
ACCN NM_001201329
ORF Size 858 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001201329.1, NP_001188258.1
RefSeq Size 5722
RefSeq ORF 858
Locus ID 79660
Protein Families Druggable Genome, Phosphatase
Protein Pathways Insulin signaling pathway
Gene Summary This gene encodes the catalytic subunit of the serine/theonine phosphatase, protein phosphatase-1. The encoded protein is expressed in liver and skeletal muscle tissue and may be involved in regulating glycogen synthesis in these tissues. This gene may be a involved in type 2 diabetes and maturity-onset diabetes of the young. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.