HMGN3 (NM_001201362) Human Untagged Clone

CAT#: SC331414

HMGN3 (untagged) - Homo sapiens high mobility group nucleosomal binding domain 3 (HMGN3), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HMGN3
• Synonyms: PNAS-24; PNAS-25; TRIP7
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001201362, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCGAAGAGAAAGTCTCCAGAGAATACAGAGGGCAAAGATGGATCCAAAGTAACTAAACAGGAGCCCA
  CAAGACGGTCTGCCAGATTGTCAGCGAAACCTGCTCCACCAAAACCTGAACCCAAACCAAGAAAAACATC
  TGCTAAGAAAGAACCTGGAGCAAAGATTAGCAGAGGTGCTAAAGGGAAGAAGGAGGAAAAGCAGGAAGCT
  GGAAAGGAAGGTACTGCACCATCTGAAAATGGTGAAACTAAAGCTGAAGAGGTACTTTCCATAAATACCT
  CCCACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001201362
• ORF Size: 288 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001201362.1, NP_001188291.1
• RefSeq Size: 1484
• RefSeq ORF: 288
• Locus ID: 9324
• Protein Families: Druggable Genome
• Gene Summary: The protein encoded by this gene binds thyroid hormone receptor beta in the presence of thyroid hormone. The encoded protein, a member of the HMGN protein family, is thought to reduce the compactness of the chromatin fiber in nucleosomes, thereby enhancing transcription from chromatin templates. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. There is a related pseudogene on chromosome 1. [provided by RefSeq, Jan 2016]
  Transcript Variant: This variant (3) retains an alternate segment in the 3' region compared to variant 1, which results in a different 3' coding region and 3' UTR. The resulting isoform (c) is shorter and has a distinct C-terminus compared to isoform a.