WASF2 (NM_001201404) Human Untagged Clone

CAT#: SC331421

WASF2 (untagged) - Homo sapiens WAS protein family, member 2 (WASF2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: WASF2
• Synonyms: dJ393P12.2; IMD2; SCAR2; WASF4; WAVE2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001201404, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCGTTAGTAACGAGGAACATCGAGCCAAGGCACCTGTGCCGTCAGACGTTGCCTAGCGTTAGAAGCG
  AGCTGGAATGCGTGACCAACATCACCCTGGCAAATGTCATCCGACAGCTGGGCAGCCTGAGTAAATATGC
  AGAGGACATTTTTGGAGAGCTCTTTACTCAGGCAAATACCTTTGCCTCTCGGGTAAGCTCCCTTGCTGAG
  AGGGTCGACCGACTACAGGTTAAAGTCACTCAGCTGGATCCCAAGGAAGAAGAAGTGTCACTGCAAGGAA
  TCAACACCCGAAAAGCCTTCAGAAGTTCCACCATTCAAGACCAGAAGCTTTTTGACAGAAACTCTCTCCC
  AGTGCCTGTCTTAGAAACATACAATACCTGTGATACTCCTCCCCCTCTCAACAATCTTACCCCTTACAGG
  GACGATGGAAAAGAGGCACTCAAATTCTACACAGACCCTTCATACTTCTTTGATCTTTGGAAGGAGAAGA
  TGCTGCAGGACACCAAGGATATCATGAAAGAGAAGAGAAAGCATAGGAAAGAAAAGAAAGATAATCCAAA
  TCGAGGGAATGTAAACCCACGTAAAATCAAGACACGTAAGGAAGAGTGGGAGAAAATGAAGATGGGGCAA
  GAATTTGTGGAGTCCAAAGAAAAGCTGGGGACTTCTGGGTATCCACCCACTTTGGTGTACCAGAATGGCA
  GCATTGGCTGTGTTGAAAACGTGGATGCAAGTAGCTATCCGCCACCACCACAGTCAGACTCTGCTTCTTC
  ACCTTCTCCTTCCTTCTCCGAGGACAACTTGCCTCCTCCACCAGCAGAATTCAGGTTTTCAGCTGCGCAG
  GGTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001201404
• ORF Size: 846 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001201404.1, NP_001188333.1
• RefSeq Size: 5161
• RefSeq ORF: 846
• Locus ID: 10163
• Protein Families: Druggable Genome
• Protein Pathways: Adherens junction, Fc gamma R-mediated phagocytosis, Regulation of actin cytoskeleton
• Gene Summary: This gene encodes a member of the Wiskott-Aldrich syndrome protein family. The gene product is a protein that forms a multiprotein complex that links receptor kinases and actin. Binding to actin occurs through a C-terminal verprolin homology domain in all family members. The multiprotein complex serves to tranduce signals that involve changes in cell shape, motility or function. The published map location (PMID:10381382) has been changed based on recent genomic sequence comparisons, which indicate that the expressed gene is located on chromosome 1, and a pseudogene may be located on chromosome X. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
  Transcript Variant: This variant (2) lacks an alternate exon compared to variant 1, that causes a frameshift. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.