Corticotropin Releasing Factor Receptor 2 (CRHR2) (NM_001202482) Human Untagged Clone

CAT#: SC331460

CRHR2 (untagged) - Homo sapiens corticotropin releasing hormone receptor 2 (CRHR2), transcript variant 4


  "NM_001202482" in other vectors (2)

Reconstitution Protocol

USD 410.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "CRHR2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CRHR2
Synonyms CRF-RB; CRF2; CRFR2; HM-CRF
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001202482, the custom clone sequence may differ by one or more nucleotides


ATGGACGCGGCACTGCTCCACAGCCTGCTGGAGGCCAACTGCAGCCTGGCGCTGGCTGAAGAGCTGCTCT
TGGACGGCTGGGGGCCACCCCTGGACCCCGAGGGTCCCTACTCCTACTGCAACACGACCTTGGACCAGAT
CGGAACGTGCTGGCCCCGCAGCGCTGCCGGAGCCCTCGTGGAGAGGCCGTGCCCCGAGTACTTCAACGGC
GTCAAGTACAACACGACCCGGAATGCCTATCGAGAATGCTTGGAGAATGGGACGTGGGCCTCAAAGATCA
ACTACTCACAGTGTGAGCCCATTTTGGATGACAAGAGGAAGTATGACCTGCACTACCGCATCGCCCTTGT
CGTCAACTACCTGGGCCACTGCGTATCTGTGGCAGCCCTGGTGGCCGCCTTCCTGCTTTTCCTGGCCCTG
CGGAGCATTCGCTGTCTGCGGAATGTGATTCACTGGAACCTCATCACCACCTTTATCCTGCGAAATGTCA
TGTGGTTCCTGCTGCAGCTCGTTGACCATGAAGTGCACGAGAGCAATGAGGTCTGGTGCCGCTGCATCAC
CACCATCTTCAACTACTTCGTGGTGACCAACTTCTTCTGGATGTTTGTGGAAGGCTGCTACCTGCACACG
GCCATTGTCATGACCTACTCCACTGAGCGCCTGCGCAAGTGCCTCTTCCTCTTCATCGGATGGTGCATCC
CCTTCCCCATCATCGTCGCCTGGGCCATCGGCAAGCTCTACTATGAGAATGAACAGTGCTGGTTTGGCAA
GGAGCCTGGCGACCTGGTGGACTACATCTACCAAGGCCCCATCATTCTCGTGCTCCTGATCAATTTCGTA
TTTCTGTTCAACATCGTCAGGATCCTAATGACAAAGTTACGCGCGTCCACCACATCCGAGACAATCCAGT
ACAGGAAGGCAGTGAAGGCCACCCTGGTGCTCCTGCCCCTCCTGGGCATCACCTACATGCTCTTCTTCGT
CAATCCCGGGGAGGACGACCTGTCACAGATCATGTTCATCTATTTCAACTCCTTCCTGCAGTCGTTCCAG
GGTTTCTTCGTGTCTGTCTTCTACTGCTTCTTCAATGGAGAGGTGCGCTCAGCCGTGAGGAAGAGGTGGC
ACCGCTGGCAGGACCATCACTCCCTTCGAGTCCCCATGGCCCGGGCCATGTCCATCCCTACATCACCCAC
ACGGATCAGCTTCCACAGCATCAAGCAGACGGCCGCTGTGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001202482
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001202482.1, NP_001189411.1
RefSeq Size 2995 bp
RefSeq ORF 1233 bp
Locus ID 1395
Cytogenetics 7p14.3
Protein Families Druggable Genome, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary 'The protein encoded by this gene belongs to the G-protein coupled receptor 2 family, and the subfamily of corticotropin releasing hormone receptor. This receptor shows high affinity for corticotropin releasing hormone (CRH), and also binds CRH-related peptides such as urocortin. CRH is synthesized in the hypothalamus, and plays an important role in coordinating the endocrine, autonomic, and behavioral responses to stress and immune challenge. Studies in mice suggest that this receptor maybe involved in mediating cardiovascular homeostasis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jan 2011]'
Transcript Variant: This variant (4) uses an alternate in-frame acceptor splice site at one of the coding exons compared to variant 1, resulting in an isoform (4, also known as isoform desQ) 1 aa shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.