CD44 (NM_001202555) Human Untagged Clone

CAT#: SC331470

CD44 (untagged) - Homo sapiens CD44 molecule (Indian blood group) (CD44), transcript variant 6


  "NM_001202555" in other vectors (2)

Reconstitution Protocol

USD 430.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "CD44"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CD44
Synonyms CDW44; CSPG8; ECMR-III; HCELL; HUTCH-I; IN; LHR; MC56; MDU2; MDU3; MIC4; Pgp1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001202555, the custom clone sequence may differ by one or more nucleotides


ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCGCAGATCGATT
TGAATATAACCTGCCGCTTTGCAGGTGTATTCCACGTGGAGAAAAATGGTCGCTACAGCATCTCTCGGAC
GGAGGCCGCTGACCTCTGCAAGGCTTTCAATAGCACCTTGCCCACAATGGCCCAGATGGAGAAAGCTCTG
AGCATCGGATTTGAGACCTGCAGGTATGGGTTCATAGAAGGGCACGTGGTGATTCCCCGGATCCACCCCA
ACTCCATCTGTGCAGCAAACAACACAGGGGTGTACATCCTCACATCCAACACCTCCCAGTATGACACATA
TTGCTTCAATGCTTCAGCTCCACCTGAAGAAGATTGTACATCAGTCACAGACCTGCCCAATGCCTTTGAT
GGACCAATTACCATAACTATTGTTAACCGTGATGGCACCCGCTATGTCCAGAAAGGAGAATACAGAACGA
ATCCTGAAGACATCTACCCCAGCAACCCTACTGATGATGACGTGAGCAGCGGCTCCTCCAGTGAAAGGAG
CAGCACTTCAGGAGGTTACATCTTTTACACCTTTTCTACTGTACACCCCATCCCAGACGAAGACAGTCCC
TGGATCACCGACAGCACAGACAGAATCCCTGCTACCAATAGGAATGATGTCACAGGTGGAAGAAGAGACC
CAAATCATTCTGAAGGCTCAACTACTTTACTGGAAGGTTATACCTCTCATTACCCACACACGAAGGAAAG
CAGGACCTTCATCCCAGTGACCTCAGCTAAGACTGGGTCCTTTGGAGTTACTGCAGTTACTGTTGGAGAT
TCCAACTCTAATGTCAATCGTTCCTTATCAGGAGACCAAGACACATTCCACCCCAGTGGGGGGTCCCATA
CCACTCATGGATCTGAATCAGATGGACACTCACATGGGAGTCAAGAAGGTGGAGCAAACACAACCTCTGG
TCCTATAAGGACACCCCAAATTCCAGAATGGCTGATCATCTTGGCATCCCTCTTGGCCTTGGCTTTGATT
CTTGCAGTTTGCATTGCAGTCAACAGTCGAAGAAGGTGTGGGCAGAAGAAAAAGCTAGTGATCAACAGTG
GCAATGGAGCTGTGGAGGACAGAAAGCCAAGTGGACTCAACGGAGAGGCCAGCAAGTCTCAGGAAATGGT
GCATTTGGTGAACAAGGAGTCGTCAGAAACTCCAGACCAGTTTATGACAGCTGATGAGACAAGGAACCTG
CAGAATGTGGACATGAAGATTGGGGTGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001202555
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001202555.1, NP_001189484.1
RefSeq Size 4809 bp
RefSeq ORF 1290 bp
Locus ID 960
Cytogenetics 11p13
Protein Families Adult stem cells, Cancer stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Stem cell relevant signaling - DSL/Notch pathway, Transmembrane
Protein Pathways ECM-receptor interaction, Hematopoietic cell lineage
Gene Summary 'The protein encoded by this gene is a cell-surface glycoprotein involved in cell-cell interactions, cell adhesion and migration. It is a receptor for hyaluronic acid (HA) and can also interact with other ligands, such as osteopontin, collagens, and matrix metalloproteinases (MMPs). This protein participates in a wide variety of cellular functions including lymphocyte activation, recirculation and homing, hematopoiesis, and tumor metastasis. Transcripts for this gene undergo complex alternative splicing that results in many functionally distinct isoforms, however, the full length nature of some of these variants has not been determined. Alternative splicing is the basis for the structural and functional diversity of this protein, and may be related to tumor metastasis. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (6), also known as CD44R2, lacks multiple coding-exons compared to variant 1. The translation remains in-frame. The resulting isoform (6) lacks an internal segment, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. This RefSeq record represents the CD44*001.1.1 allele.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.