UCP4 (SLC25A27) (NM_001204051) Human Untagged Clone
CAT#: SC331483
SLC25A27 (untagged) - Homo sapiens solute carrier family 25, member 27 (SLC25A27), transcript variant 2
"NM_001204051" in other vectors (2)
Product Images
Other products for "SLC25A27"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SLC25A27 |
Synonyms | UCP4 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001204051, the custom clone sequence may differ by one or more nucleotides
ATGTCCGTCCCGGAGGAGGAGGAGAGGCTTTTGCCGCTGACCCAGAGATGGCCCCGAGCGAGCAAATTCC TACTGTCCGGCTGCGCGGCTACCGTGGCCGAGCTAGCAACCTTTCCCCTGGATCTCACAAAAACTCGACT CCAAATGCAAGGAGAAGCAGCTCTTGCTCGGTTGGGAGACGGTGCAAGAGAATCTGCCCCCTATAGGGGA ATGGTGCGCACAGCTCTAGGGATCATTGAAGAGGAAGGCTTTCTAAAGCTTTGGCAAGGAGTGACACCCG CCATTTACAGACACGTAGTGTATTCTGGAGGTCGAATGGTCACATATGAACATCTCCGAGAGGTTGTGTT TGGCAAAAGTGAAGATGAGCATTATCCCCTTTGGAAATCAGTCATTGGAGGGATGATGGCTGGTGTTATT GGCCAGTTTTTAGCCAATCCAACTGACCTAGTGAAGGTTCAGATGCAAATGGAAGGAAAAAGGAAACTGG AAGGAAAACCATTGCGATTTCGTGGTGTACATCATGCATTTGCAAAAATCTTAGCTGAAGGAGGAATACG AGGGCTTTGGGCAGGCTGGGTACCCAATATACAAAGAGCAGCACTGGTGAATATGGGAGATTTAACCACT TATGATACAGTGAAACACTACTTGGTATTGAATACACCACTTGAGGACAATATCATGACTCACGGTTTAT CAAGTTTATGTTCTGGACTGGTAGCTTCTATTCTGGGAACACCAGCCGATGTCATCAAAAGCAGAATAAT GAATCAACCACGAGATAAACAAGGAAGGGGACTTTTGTATAAATCATCGACTGACTGCTTGATTCAGGCT GTTCAAGGTGAAGGATTCATGAGTCTATATAAAGGCTTTTTACCATCTTGGCTGAGAATGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001204051 |
ORF Size | 903 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001204051.1, NP_001190980.1 |
RefSeq Size | 2722 |
RefSeq ORF | 903 |
Locus ID | 9481 |
Protein Families | Druggable Genome |
Gene Summary | Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. Transcripts of this gene are only detected in brain tissue and are specifically modulated by various environmental conditions. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2011] Transcript Variant: This variant (2) differs in the 3' UTR and lacks a portion of the 3' coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.