MDMX (MDM4) (NM_001204171) Human Untagged Clone

CAT#: SC331512

MDM4 (untagged) - Homo sapiens Mdm4 p53 binding protein homolog (mouse) (MDM4), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MDM4
• Synonyms: HDMX; MDMX; MRP1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001204171, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACATCATTTTCCACCTCTGCTCAGTGTTCAACATCTGACAGTGCTTGCAGGATCTCTCCTGGACAAA
  TCAATCAGGTACGACCAAAACTGCCGCTTTTGAAGATTTTGCATGCAGCAGGTGCGCAAGGTGAAATGTT
  CACTGTTAAAGAGGTCATGCACTATTTAGGTCAGTACATAATGGTGAAGCAACTTTATGATCAGCAGGAG
  CAGCATATGGTATATTGTGGTGGAGATCTTTTGGGAGAACTACTGGGACGTCAGAGCTTCTCCGTGAAAG
  ACCCAAGCCCTCTCTATGATATGCTAAGAAAGAATCTTGTCACTTTAGCCACTGCTACTACAGATGCTGC
  TCAGACTCTCGCTCTCGCACAGGATCACAGTATGGATATTCCAAGTCAAGACCAACTGAAGCAAAGTGCA
  GAGGAAAGTTCCACTTCCAGAAAAAGAACTACAGAAGACGATATCCCCACACTGCCTACCTCAGAGCATA
  AATGCATACATTCTAGAGAAGATGAAGACTTAATTGAAAATTTAGCCCAAGATGAAACATCTAGGCTGGA
  CCTTGGATTTGAGGAGTGGGATGTAGCTGGCCTGCCTTGGTGGTTTTTAGGAAACTTGAGAAGCAACTAT
  ACACCTAGAAGTAATGGCTCAACTGATTTACAGACAAATCAGGTGATTGAAGTGGGAAAAAATGATGACC
  TGGAGGACTCTAAGTCCTTAAGTGATGATACCGATGTAGAGGTTACCTCTGAGGATGAGTGGCAGTGTAC
  TGAATGCAAGAAATTTAACTCTCCAAGCAAGAGGTACTGTTTTCGTTGTTGGGCCTTGAGGAAGGATTGG
  TATTCAGATTGTTCAAAGTTAACCCATTCTCTCTCCACGTCTGATATCACTGCCATACCTGAAAAGGAAA
  ATGAAGGAAATGATGTCCCTGATTGTCGAAGAACCATTTCGGCTCCTGTCGTTAGACCTAAAGATGCGTA
  TATAAAGAAAGAAAACTCCAAACTTTTTGATCCCTGCAACTCAGTGGAATTCTTGGATTTGGCTCACAGT
  TCTGAAAGCCAAGAGACCATCTCAAGCATGGGAGAACAGTTAGATAACCTTTCTGAACAGAGAACAGATA
  CAGAAAACATGGAGGATTGCCAGAATCTCTTGAAGCCATGTAGCTTATGTGAGAAAAGACCACGAGACGG
  GAACATTATTCATGGAAGGACGGGCCATCTTGTCACTTGTTTTCACTGTGCCAGAAGACTAAAGAAGGCT
  GGGGCTTCATGCCCTATTTGCAAGAAAGAGATTCAGCTGGTTATTAAGGTTTTTATAGCATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001204171
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001204171.1, NP_001191100.1
• RefSeq Size: 9940 bp
• RefSeq ORF: 1323 bp
• Locus ID: 4194
• Cytogenetics: 1q32.1
• Protein Families: Druggable Genome, Transcription Factors
• Protein Pathways: p53 signaling pathway
• Gene Summary: 'This gene encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppressor protein and inhibit its activity, and have been shown to be overexpressed in a variety of human cancers. However, unlike MDM2 which degrades p53, this protein inhibits p53 by binding its transcriptional activation domain. This protein also interacts with MDM2 protein via the RING finger domain, and inhibits the latter's degradation. So this protein can reverse MDM2-targeted degradation of p53, while maintaining suppression of p53 transactivation and apoptotic functions. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Feb 2011]'
  Transcript Variant: This variant (2, also known as MDM4-A or HDMX-A) lacks an in-frame coding exon compared to variant 1, resulting in a shorter isoform (2) missing an internal protein segment in the 3' coding region compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.