NEK2 (NM_001204183) Human Untagged Clone

CAT#: SC331516

NEK2 (untagged) - Homo sapiens NIMA-related kinase 2 (NEK2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NEK2
• Synonyms: HsPK21; NEK2A; NLK1; PPP1R111; RP67
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001204183, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCTTCCCGGGCTGAGGACTATGAAGTGTTGTACACCATTGGCACAGGCTCCTACGGCCGCTGCCAGA
  AGATCCGGAGGAAGAGTGATGGCAAGATATTAGTTTGGAAAGAACTTGACTATGGCTCCATGACAGAAGC
  TGAGAAACAGATGCTTGTTTCTGAAGTGAATTTGCTTCGTGAACTGAAACATCCAAACATCGTTCGTTAC
  TATGATCGGATTATTGACCGGACCAATACAACACTGTACATTGTAATGGAATATTGTGAAGGAGGGGATC
  TGGCTAGTGTAATTACAAAGGGAACCAAGGAAAGGCAATACTTAGATGAAGAGTTTGTTCTTCGAGTGAT
  GACTCAGTTGACTCTGGCCCTGAAGGAATGCCACAGACGAAGTGATGGTGGTCATACCGTATTGCATCGG
  GATCTGAAACCAGCCAATGTTTTCCTGGATGGCAAGCAAAACGTCAAGCTTGGAGACTTTGGGCTAGCTA
  GAATATTAAACCATGACACGAGTTTTGCAAAAACATTTGTTGGCACACCTTATTACATGTCTCCTGAACA
  AATGAATCGCATGTCCTACAATGAGAAATCAGATATCTGGTCATTGGGCTGCTTGCTGTATGAGTTATGT
  GCATTAATGCCTCCATTTACAGCTTTTAGCCAGAAAGAACTCGCTGGGAAAATCAGAGAAGGCAAATTCA
  GGCGAATTCCATACCGTTACTCTGATGAATTGAATGAAATTATTACGAGGATGTTAAACTTAAAGGATTA
  CCATCGACCTTCTGTTGAAGAAATTCTTGAGAACCCTTTAATAGCAGATTTGGTTGCAGACGAGCAAAGA
  AGAAATCTTGAGAGAAGAGGGCGACAATTAGGAGAGCCAGAAAAATCGCAGGATTCCAGCCCTGTATTGA
  GTGAGCTGAAACTGAAGGAAATTCAGTTACAGGAGCGAGAGCGAGCTCTCAAAGCAAGAGAAGAAAGATT
  GGAGCAGAAAGAACAGGAGCTTTGTGTTCGTGAGAGACTAGCAGAGGACAAACTGGCTAGAGCAGAAAAT
  CTGTTGAAGAACTACAGCTTGCTAAAGGAACGGAAGTTCCTGTCTCTGGCAAGTAATCCAGGTATGAGAA
  TCAACTTGGTCAACAGAAGCTGGTGCTACAAATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001204183
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001204183.1, NP_001191112.1
• RefSeq Size: 1938 bp
• RefSeq ORF: 1155 bp
• Locus ID: 4751
• Cytogenetics: 1q32.3
• Protein Families: Druggable Genome, Protein Kinase
• Gene Summary: 'This gene encodes a serine/threonine-protein kinase that is involved in mitotic regulation. This protein is localized to the centrosome, and undetectable during G1 phase, but accumulates progressively throughout the S phase, reaching maximal levels in late G2 phase. Alternatively spliced transcript variants encoding different isoforms with distinct C-termini have been noted for this gene. [provided by RefSeq, Feb 2011]'
  Transcript Variant: This variant (2) differs at the 3' end compared to variant 1. This results in a frame-shift and a shorter isoform (2, also known as NEK2B) with a distinct C-terminus compared to isoform 1. Isoforms 1 and 2 have been reported to exhibit distinct pattern of expression during mitosis (PMID:11742531).