p73 (TP73) (NM_001204186) Human Untagged Clone

CAT#: SC331519

TP73 (untagged) - Homo sapiens tumor protein p73 (TP73), transcript variant 10


  "NM_001204186" in other vectors (2)

Reconstitution Protocol

USD 400.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "TP73"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TP73
Synonyms P73
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001204186, the custom clone sequence may differ by one or more nucleotides


ATGGCCCAGTCCACCGCCACCTCCCCTGATGGGGGCACCACGTTTGAGCACCTCTGGAGCTCTCTGGAAC
CAGACAGCACCTACTTCGACCTTCCCCAGTCAAGCCGGGGGAATAATGAGGTGGTGGGCGGAACGGATTC
CAGCATGGACGTCTTCCACCTGGAGGGCATGACTACATCTGTCATGGCCCAGTTCAATCTGCTGAGCAGC
ACCATGGACCAGATGAGCAGCCGCGCGGCCTCGGCCAGCCCCTACACCCCAGAGCACGCCGCCAGCGTGC
CCACCCACTCGCCCTACGCACAACCCAGCTCCACCTTCGACACCATGTCGCCGGCGCCTGTCATCCCCTC
CAACACCGACTACCCCGGACCCCACCACTTTGAGGTCACTTTCCAGCAGTCCAGCACGGCCAAGTCAGCC
ACCTGGACGTACTCCCCGCTCTTGAAGAAACTCTACTGCCAGATCGCCAAGACATGCCCCATCCAGATCA
AGGTGTCCACCCCGCCACCCCCAGGCACCGCCATCCGGGCCATGCCTGTTTACAAGAAAGCGGAGCACGT
GACCGACGTCGTGAAACGCTGCCCCAACCACGAGCTCGGGAGGGACTTCAACGAAGGACAGTCTGCTCCA
GCCAGCCACCTCATCCGCGTGGAAGGCAATAATCTCTCGCAGTATGTGGATGACCCTGTCACCGGCAGGC
AGAGCGTCGTGGTGCCCTATGAGCCACCACAGGTGGGGACGGAATTCACCACCATCCTGTACAACTTCAT
GTGTAACAGCAGCTGTGTAGGGGGCATGAACCGGCGGCCCATCCTCATCATCATCACCCTGGAGATGCGG
GATGGGCAGGTGCTGGGCCGCCGGTCCTTTGAGGGCCGCATCTGCGCCTGTCCTGGCCGCGACCGAAAAG
CTGATGAGGACCACTACCGGGAGCAGCAGGCCCTGAACGAGAGCTCCGCCAAGAACGGGGCCGCCAGCAA
GCGTGCCTTCAAGCAGAGCCCCCCTGCCGTCCCCGCCCTTGGTGCCGGTGTGAAGAAGCGGCGGCATGGA
GACGAGGACACGTACTACCTTCAGGTGCGAGGCCGGGAGAACTTTGAGATCCTGATGAAGCTGAAAGAGA
GCCTGGAGCTGATGGAGTTGGTGCCGCAGCCACTGGTGGACTCCTATCGGCAGCAGCAGCAGCTCCTACA
GAGGCCGACCTGGGGGCCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001204186
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204186.1, NP_001191115.1
RefSeq Size 4772 bp
RefSeq ORF 1212 bp
Locus ID 7161
Cytogenetics 1p36.32
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Neurotrophin signaling pathway, p53 signaling pathway
Gene Summary 'This gene encodes a member of the p53 family of transcription factors involved in cellular responses to stress and development. It maps to a region on chromosome 1p36 that is frequently deleted in neuroblastoma and other tumors, and thought to contain multiple tumor suppressor genes. The demonstration that this gene is monoallelically expressed (likely from the maternal allele), supports the notion that it is a candidate gene for neuroblastoma. Many transcript variants resulting from alternative splicing and/or use of alternate promoters have been found for this gene, but the biological validity and the full-length nature of some variants have not been determined. [provided by RefSeq, Feb 2011]'
Transcript Variant: This variant (10) lacks three alternate coding exons compared to variant 1, that causes a frameshift. The resulting isoform (j, also known as TA p73 delta) has a shorter and distinct C-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. There are no full-length transcripts supporting this RefSeq in human; it is predicted based on partial transcript alignments and on full-length transcript support reported in PMID:12154353.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.