p73 (TP73) (NM_001204189) Human Untagged Clone
CAT#: SC331522
TP73 (untagged) - Homo sapiens tumor protein p73 (TP73), transcript variant 5
"NM_001204189" in other vectors (2)
Product Images
Other products for "TP73"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TP73 |
Synonyms | P73 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001204189, the custom clone sequence may differ by one or more nucleotides
ATGCTGTACGTCGGTGACCCCGCACGGCACCTCGCCACGGCCCAGTTCAATCTGCTGAGCAGCACCATGG ACCAGATGAGCAGCCGCGCGGCCTCGGCCAGCCCCTACACCCCAGAGCACGCCGCCAGCGTGCCCACCCA CTCGCCCTACGCACAACCCAGCTCCACCTTCGACACCATGTCGCCGGCGCCTGTCATCCCCTCCAACACC GACTACCCCGGACCCCACCACTTTGAGGTCACTTTCCAGCAGTCCAGCACGGCCAAGTCAGCCACCTGGA CGTACTCCCCGCTCTTGAAGAAACTCTACTGCCAGATCGCCAAGACATGCCCCATCCAGATCAAGGTGTC CACCCCGCCACCCCCAGGCACCGCCATCCGGGCCATGCCTGTTTACAAGAAAGCGGAGCACGTGACCGAC GTCGTGAAACGCTGCCCCAACCACGAGCTCGGGAGGGACTTCAACGAAGGACAGTCTGCTCCAGCCAGCC ACCTCATCCGCGTGGAAGGCAATAATCTCTCGCAGTATGTGGATGACCCTGTCACCGGCAGGCAGAGCGT CGTGGTGCCCTATGAGCCACCACAGGTGGGGACGGAATTCACCACCATCCTGTACAACTTCATGTGTAAC AGCAGCTGTGTAGGGGGCATGAACCGGCGGCCCATCCTCATCATCATCACCCTGGAGATGCGGGATGGGC AGGTGCTGGGCCGCCGGTCCTTTGAGGGCCGCATCTGCGCCTGTCCTGGCCGCGACCGAAAAGCTGATGA GGACCACTACCGGGAGCAGCAGGCCCTGAACGAGAGCTCCGCCAAGAACGGGGCCGCCAGCAAGCGTGCC TTCAAGCAGAGCCCCCCTGCCGTCCCCGCCCTTGGTGCCGGTGTGAAGAAGCGGCGGCATGGAGACGAGG ACACGTACTACCTTCAGGTGCGAGGCCGGGAGAACTTTGAGATCCTGATGAAGCTGAAAGAGAGCCTGGA GCTGATGGAGTTGGTGCCGCAGCCACTGGTGGACTCCTATCGGCAGCAGCAGCAGCTCCTACAGAGGCCG ACCTGGGGGCCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001204189 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001204189.1, NP_001191118.1 |
RefSeq Size | 4749 bp |
RefSeq ORF | 1065 bp |
Locus ID | 7161 |
Cytogenetics | 1p36.32 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Neurotrophin signaling pathway, p53 signaling pathway |
Gene Summary | 'This gene encodes a member of the p53 family of transcription factors involved in cellular responses to stress and development. It maps to a region on chromosome 1p36 that is frequently deleted in neuroblastoma and other tumors, and thought to contain multiple tumor suppressor genes. The demonstration that this gene is monoallelically expressed (likely from the maternal allele), supports the notion that it is a candidate gene for neuroblastoma. Many transcript variants resulting from alternative splicing and/or use of alternate promoters have been found for this gene, but the biological validity and the full-length nature of some variants have not been determined. [provided by RefSeq, Feb 2011]' Transcript Variant: This variant (5) differs in the 5' UTR and coding sequence and lacks three alternate coding exons compared to variant 1, that causes a frameshift. The resulting isoform (3, also known as deltaN p73 delta) has a shorter and distinct N-terminus and a shorter and distinct C-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. There are no full-length transcripts supporting this RefSeq in human; it is predicted based on partial transcript alignments and on full-length transcript support reported in PMID:12154353. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.