Kv1.2 (KCNA2) (NM_001204269) Human Untagged Clone

CAT#: SC331540

KCNA2 (untagged) - Homo sapiens potassium voltage-gated channel, shaker-related subfamily, member 2 (KCNA2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KCNA2
• Synonyms: EIEE32; HBK5; HK4; HUKIV; KV1.2; MK2; NGK1; RBK2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001204269, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACAGTGGCCACCGGAGACCCAGCAGACGAGGCTGCTGCCCTCCCTGGGCACCCACAGGACACCTATG
  ACCCAGAGGCAGACCACGAGTGCTGTGAGAGGGTGGTGATCAACATCTCAGGGCTGCGGTTTGAGACCCA
  GCTAAAGACCTTAGCCCAGTTTCCAGAGACCCTCTTAGGGGACCCAAAGAAACGAATGAGGTACTTTGAC
  CCCCTCCGAAATGAGTACTTTTTCGATCGGAACCGCCCTAGCTTTGATGCCATTTTGTACTACTACCAGT
  CAGGGGGCCGATTGAGGCGACCTGTGAATGTGCCCTTAGATATATTCTCTGAAGAAATTCGGTTTTATGA
  GCTGGGAGAAGAAGCGATGGAGATGTTTCGGGAAGATGAAGGCTACATCAAGGAGGAAGAGCGTCCTCTG
  CCTGAAAATGAGTTTCAGAGACAAGTGTGGCTTCTCTTTGAATACCCAGAGAGCTCAGGGCCTGCCAGGA
  TTATAGCTATTGTGTCTGTCATGGTGATTCTGATCTCAATTGTCAGCTTCTGTCTGGAAACATTGCCCAT
  CTTCCGGGATGAGAATGAAGACATGCATGGTAGTGGGGTGACCTTCCACACCTATTCCAACAGCACCATC
  GGGTACCAGCAGTCCACTTCCTTCACAGACCCTTTCTTCATTGTAGAGACACTCTGCATCATCTGGTTCT
  CCTTTGAATTCTTGGTGAGGTTCTTTGCCTGTCCCAGCAAAGCCGGCTTCTTCACCAACATCATGAACAT
  CATTGACATTGTGGCCATCATCCCCTACTTCATCACCCTGGGGACAGAGTTGGCTGAGAAGCCAGAGGAC
  GCTCAGCAAGGCCAGCAGGCCATGTCACTGGCCATCCTCCGTGTCATCCGGTTGGAACGCAGACCTCTGC
  AAAGCCAGAAGAGTAAGCGGGGAAGGCAGCATCTGAACACCTCACATGACTGCACCTTAGGAATTAACCT
  AGTCGCGGGCATGACTGTACAGTGGACCAGGGCATCTGGTCCTGATGACAGGCAGACACCAGCTGTAACT
  ACATTGCACAGGATGTATTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001204269
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001204269.1, NP_001191198.1
• RefSeq Size: 2022 bp
• RefSeq ORF: 1071 bp
• Locus ID: 3737
• Cytogenetics: 1p13.3
• Protein Families: Druggable Genome, Ion Channels: Potassium, Transmembrane
• Gene Summary: 'Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, members of which allow nerve cells to efficiently repolarize following an action potential. The coding region of this gene is intronless, and the gene is clustered with genes KCNA3 and KCNA10 on chromosome 1. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) has multiple differences, compared to variant 1. These differences result in distinct 5' and 3' ends and cause translation termination at a downstream stop codon, compared to variant 1. The encoded protein (isoform b) is shorter than isoform a.