FLAP (ALOX5AP) (NM_001204406) Human Untagged Clone
CAT#: SC331572
ALOX5AP (untagged) - Homo sapiens arachidonate 5-lipoxygenase-activating protein (ALOX5AP), transcript variant 2
"NM_001204406" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ALOX5AP |
Synonyms | FLAP |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001204406, the custom clone sequence may differ by one or more nucleotides
ATGCTCACATTTAATCACGATGCTCCCTGGCATACACAGAAGACTCTGAAAACTTCTGAATTTGGGAAAT CCTTTGGCACCTTGGGGCACATTGGGAACATAAGCCATCAGTGCTGGGCAGGTTGTGCAGCTGGAGGCAG AGCAGTCCTCTCTGGGGAGCCTGAAGCAAACATGGATCAAGAAACTGTAGGCAATGTTGTCCTGTTGGCC ATCGTCACCCTCATCAGCGTGGTCCAGAATGGATTCTTTGCCCATAAAGTGGAGCACGAAAGCAGGACCC AGAATGGGAGGAGCTTCCAGAGGACCGGAACACTTGCCTTTGAGCGGGTCTACACTGCCAACCAGAACTG TGTAGATGCGTACCCCACTTTCCTCGCTGTGCTCTGGTCTGCGGGGCTACTTTGCAGCCAAGTTCCTGCT GCGTTTGCTGGACTGATGTACTTGTTTGTGAGGCAAAAGTACTTTGTCGGTTACCTAGGAGAGAGAACGC AGAGCACCCCTGGCTACATATTTGGGAAACGCATCATACTCTTCCTGTTCCTCATGTCCGTTGCTGGCAT ATTCAACTATTACCTCATCTTCTTTTTCGGAAGTGACTTTGAAAACTACATAAAGACGATCTCCACCACC ATCTCCCCTCTACTTCTCATTCCCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001204406 |
ORF Size | 657 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001204406.1, NP_001191335.1 |
RefSeq Size | 1242 |
RefSeq ORF | 657 |
Locus ID | 241 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a protein which, with 5-lipoxygenase, is required for leukotriene synthesis. Leukotrienes are arachidonic acid metabolites which have been implicated in various types of inflammatory responses, including asthma, arthritis and psoriasis. This protein localizes to the plasma membrane. Inhibitors of its function impede translocation of 5-lipoxygenase from the cytoplasm to the cell membrane and inhibit 5-lipoxygenase activation. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Feb 2011] Transcript Variant: This variant (2) has an alternate 5' sequence which includes an upstream in-frame AUG start codon, as compared to variant 1. The resulting isoform (2) is longer at the N-terminus, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233468 | ALOX5AP (Myc-DDK tagged) - Homo sapiens arachidonate 5-lipoxygenase-activating protein (ALOX5AP), transcript variant 2 |
USD 420.00 |
|
RG233468 | ALOX5AP (GFP-tagged) - Homo sapiens arachidonate 5-lipoxygenase-activating protein (ALOX5AP), transcript variant 2 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review