FLAP (ALOX5AP) (NM_001204406) Human Untagged Clone

CAT#: SC331572

ALOX5AP (untagged) - Homo sapiens arachidonate 5-lipoxygenase-activating protein (ALOX5AP), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ALOX5AP
• Synonyms: FLAP
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001204406, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTCACATTTAATCACGATGCTCCCTGGCATACACAGAAGACTCTGAAAACTTCTGAATTTGGGAAAT
  CCTTTGGCACCTTGGGGCACATTGGGAACATAAGCCATCAGTGCTGGGCAGGTTGTGCAGCTGGAGGCAG
  AGCAGTCCTCTCTGGGGAGCCTGAAGCAAACATGGATCAAGAAACTGTAGGCAATGTTGTCCTGTTGGCC
  ATCGTCACCCTCATCAGCGTGGTCCAGAATGGATTCTTTGCCCATAAAGTGGAGCACGAAAGCAGGACCC
  AGAATGGGAGGAGCTTCCAGAGGACCGGAACACTTGCCTTTGAGCGGGTCTACACTGCCAACCAGAACTG
  TGTAGATGCGTACCCCACTTTCCTCGCTGTGCTCTGGTCTGCGGGGCTACTTTGCAGCCAAGTTCCTGCT
  GCGTTTGCTGGACTGATGTACTTGTTTGTGAGGCAAAAGTACTTTGTCGGTTACCTAGGAGAGAGAACGC
  AGAGCACCCCTGGCTACATATTTGGGAAACGCATCATACTCTTCCTGTTCCTCATGTCCGTTGCTGGCAT
  ATTCAACTATTACCTCATCTTCTTTTTCGGAAGTGACTTTGAAAACTACATAAAGACGATCTCCACCACC
  ATCTCCCCTCTACTTCTCATTCCCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001204406
• ORF Size: 657 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001204406.1, NP_001191335.1
• RefSeq Size: 1242
• RefSeq ORF: 657
• Locus ID: 241
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: This gene encodes a protein which, with 5-lipoxygenase, is required for leukotriene synthesis. Leukotrienes are arachidonic acid metabolites which have been implicated in various types of inflammatory responses, including asthma, arthritis and psoriasis. This protein localizes to the plasma membrane. Inhibitors of its function impede translocation of 5-lipoxygenase from the cytoplasm to the cell membrane and inhibit 5-lipoxygenase activation. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Feb 2011]
  Transcript Variant: This variant (2) has an alternate 5' sequence which includes an upstream in-frame AUG start codon, as compared to variant 1. The resulting isoform (2) is longer at the N-terminus, as compared to isoform 1.