Flt3 ligand (FLT3LG) (NM_001204502) Human Untagged Clone

CAT#: SC331594

FLT3LG (untagged) - Homo sapiens fms-related tyrosine kinase 3 ligand (FLT3LG), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FLT3LG
• Synonyms: FL; FLG3L; FLT3L
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001204502, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACAGTGCTGGCGCCAGCCTGGAGCCCAACAACCTATCTCCTCCTGCTGCTGCTGCTGAGCTCGGGAC
  TCAGTGGGACCCAGGACTGCTCCTTCCAACACAGCCCCATCTCCTCCGACTTCGCTGTCAAAATCCGTGA
  GCTGTCTGACTACCTGCTTCAAGATTACCCAGTCACCGTGGCCTCCAACCTGCAGGACGAGGAGCTCTGC
  GGGGGCCTCTGGCGGCTGGTCCTGGCACAGCGCTGGATGGAGCGGCTCAAGACTGTCGCTGGGTCCAAGA
  TGCAAGGCTTGCTGGAGCGCGTGAACACGGAGATACACTTTGTCACCAAATGTGCCTTTCAGCCCCCCCC
  CAGCTGTCTTCGCTTCGTCCAGACCAACATCTCCCGCCTCCTGCAGGAGACCTCCGAGCAGCTGGTGGCG
  CTGAAGCCCTGGATCACTCGCCAGAACTTCTCCCGGTGCCTGGAGCTGCAGTGTCAGCCCGACTCCTCAA
  CCCTGCCACCCCCATGGAGTCCCCGGCCCCTGGAGGCCACAGCCCCGACAGCCCCGCAGCCCCCTCTGCT
  CCTCCTACTGCTGCTGCCCGTGGGCCTCCTGCTGCTGGCCGCTGCCTGGTGCCTGCACTGGCAGAGGACG
  CGGCGGAGGACACCCCGCCCTGGGGAGCAGGTGCCCCCCGTCCCCAGTCCCCAGGACCTGCTGCTTGTGG
  AGCACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001204502
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001204502.1, NP_001191431.1
• RefSeq Size: 1125 bp
• RefSeq ORF: 708 bp
• Locus ID: 2323
• Cytogenetics: 19q13.33
• Protein Families: Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein, Transmembrane
• Protein Pathways: Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Pathways in cancer
• Gene Summary: 'Dendritic cells (DCs) provide the key link between innate and adaptive immunity by recognizing pathogens and priming pathogen-specific immune responses. FLT3LG controls the development of DCs and is particularly important for plasmacytoid DCs and CD8 (see MIM 186910)-positive classical DCs and their CD103 (ITGAE; MIM 604682)-positive tissue counterparts (summary by Sathaliyawala et al., 2010 [PubMed 20933441]).[supplied by OMIM, Jan 2011]'
  Transcript Variant: This variant (1) encodes the longer isoform (1). Variants 1, 2, and 3 encode the same isoform (1).