CCN4 (NM_001204869) Human Untagged Clone
CAT#: SC331622
WISP1 (untagged) - Homo sapiens WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 3
"NM_001204869" in other vectors (2)
Product Images
Other products for "CCN4"
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | CCN4 |
| Synonyms | WISP1; WISP1-OT1; WISP1-UT1; WISP1c; WISP1i; WISP1tc |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001204869, the custom clone sequence may differ by one or more nucleotides
ATGAGGTGGTTCCTGCCCTGGACGCTGGCAGCAGTGACAGCAGCAGCCGCCAGCACCGTCCTGGCCACGG CCCTCTCTCCAGCCCCTACGACCATGGACTTTACCCCAGCTCCACTGGAGGACACCTCCTCACGCCCCCA ATTCTGCAAGTGGCCATGTGAGTGCCCGCCATCCCCACCCCGCTGCCCGCTGGGGGTCAGCCTCATCACA GATGGCTGTGAGTGCTGTAAGATGTGCGCTCAGCAGCTTGGGGACAACTGCACGGAGGCTGCCATCTGTG ACCCCCACCGGGGCCTCTACTGTGACTACAGCGGGGACCGCCCGAGGTACGCAATAGGAGTGTGTGCACG CAGGGAAGAAGTGTCTGGCTGTGTACCAGCCAGAGGCATCCATGAACTTCACACTTGCGGGCTGCATCAG CACACGCTCCTATCAACCCAAGTACTGTGGAGTTTGCATGGACAATAG |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001204869 |
| ORF Size | 468 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Reference Data | |
| RefSeq | NM_001204869.1, NP_001191798.1 |
| RefSeq Size | 4739 |
| RefSeq ORF | 468 |
| Locus ID | 8840 |
| Protein Families | Adult stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Secreted Protein, Stem cell relevant signaling - DSL/Notch pathway, Stem cell relevant signaling - Wnt Signaling pathway |
| Gene Summary | This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like domain. This gene may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. It is expressed at a high level in fibroblast cells, and overexpressed in colon tumors. The encoded protein binds to decorin and biglycan, two members of a family of small leucine-rich proteoglycans present in the extracellular matrix of connective tissue, and possibly prevents the inhibitory activity of decorin and biglycan in tumor cell proliferation. It also attenuates p53-mediated apoptosis in response to DNA damage through activation of the Akt kinase. It is 83% identical to the mouse protein at the amino acid level. Multiple alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2011] Transcript Variant: This variant (3) lacks two consecutive exons in the coding region, as compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Germany
Japan
United Kingdom
China