PBX1 (NM_001204963) Human Untagged Clone
CAT#: SC331633
PBX1 (untagged) - Homo sapiens pre-B-cell leukemia homeobox 1 (PBX1), transcript variant 3
"NM_001204963" in other vectors (2)
Product Images
Other products for "PBX1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PBX1 |
Synonyms | CAKUHED |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001204963, the custom clone sequence may differ by one or more nucleotides
ATGGACGAGCAGCCCAGGCTGATGCATTCCCATGCTGGGGTCGGGATGGCCGGACACCCCGGCCTGTCCC AGCACTTGCAGGATGGGGCCGGAGGGACCGAGGGGGAGGGCGGGAGGAAGCAGGACATTGGAGACATTTT ACAGCAAATTATGACCATCACAGACCAGAGTTTGGATGAGGCGCAGGCCAGAAAACATGCTTTAAACTGC CACAGAATGAAGCCTGCCTTGTTTAATGTGTTGTGTGAAATCAAAGAAAAAACAGTTTTGAGTATCCGAG GAGCCCAGGAGGAGGAACCCACAGACCCCCAGCTGATGCGGCTGGACAACATGCTGTTAGCGGAAGGCGT GGCGGGGCCTGAGAAGGGCGGAGGGTCGGCGGCAGCGGCGGCAGCGGCGGCGGCTTCTGGAGGGGCAGGT TCAGACAACTCAGTGGAGCATTCAGATTACAGAGCCAAACTCTCACAGATCAGACAAATCTACCATACGG AGCTGGAGAAATACGAGCAGGCCTGCAACGAGTTCACCACCCACGTGATGAATCTCCTGCGAGAGCAAAG CCGGACCAGGCCCATCTCCCCAAAGGAGATTGAGCGGATGGTCAGCATCATCCACCGCAAGTTCAGCTCC ATCCAGATGCAGCTCAAGCAGAGCACGTGCGAGGCGGTGATGATCCTGCGTTCCCGATTTCTGGATGCGC GGCGGAAGAGACGGAATTTCAACAAGCAAGCGACAGAAATCCTGAATGAATATTTCTATTCCCATCTCAG CAACCCTTACCCCAGTGAGGAAGCCAAAGAGGAGTTAGCCAAGAAGTGTGGCATCACAGTCTCCCAGGTA TCAAACTGGTTTGGAAATAAGCGAATCCGGTACAAGAAGAACATAGGTAAATTTCAAGAGGAAGCCAATA TTTATGCTGCCAAAACAGCTGTCACTGCTACCAATGTGTCAGCCCATGGAAGCCAAGCTAACTCGCCCTC AACTCCCAACTCGGCTGGTTCTTCCAGTTCTTTTAACATGTCAAACTCTGGAGATTTGTTCATGAGCGTG CAGTCACTCAATGGGGATTCTTACCAAGGGGCCCAGGTTGGAGCCAACGTGCAATCACAGGTGGATACCC TTCGCCATGTTATCAGCCAGACAGGAGGATACAGTGATGGACTCGCAGCCAGTCAGATGTACAGTCCGCA GGGCATCAGTCACCTCCCCCGGCACCCCCGGCAAGCCCACTATCACTTCCGACTTCCAACGTGGCATCCG TGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001204963 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001204963.1, NP_001191892.1 |
RefSeq Size | 4162 bp |
RefSeq ORF | 1263 bp |
Locus ID | 5087 |
Cytogenetics | 1q23.3 |
Protein Families | Druggable Genome, Stem cell - Pluripotency, Transcription Factors |
Gene Summary | 'This gene encodes a nuclear protein that belongs to the PBX homeobox family of transcriptional factors. Studies in mice suggest that this gene may be involved in the regulation of osteogenesis and required for skeletal patterning and programming. A chromosomal translocation, t(1;19) involving this gene and TCF3/E2A gene, is associated with pre-B-cell acute lymphoblastic leukemia. The resulting fusion protein, in which the DNA binding domain of E2A is replaced by the DNA binding domain of this protein, transforms cells by constitutively activating transcription of genes regulated by the PBX protein family. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2017]' Transcript Variant: This variant (3) contains an alternate 3' terminal exon compared to variant 1. This results in a frame-shift and a shorter isoform (3) with a distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.