ABH2 (ALKBH2) (NM_001205179) Human Untagged Clone

CAT#: SC331635

ALKBH2 (untagged) - Homo sapiens alkB, alkylation repair homolog 2 (E. coli) (ALKBH2), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ALKBH2
• Synonyms: ABH2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001205179, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGACAGATTCCTGGTGAAAGGGGCTCAAGGGGGCCTTTTGAGGAAGCAGGAGGAGCAAGAGCCAACTG
  GAGAAGAGCCAGCTGTGTTGGGAGGAGACAAAGAAAGCACAAGGAAGAGGCCCAGGAGAGAGGCCCCAGG
  GAATGGAGGCCACTCAGCAGGCCCTAGCTGGCGGCACATTCGGGCTGAGGGCCTGGACTGCAGTTACACA
  GTCCTGTTTGGCAAAGCTGAGGCAGATGAGATTTTCCAAGAGTTGGAGAAAGAAGTAGAATATTTTACAG
  GTATAAAGATGGCTGTGACCACATCGGGGAGCACCGAGATGATGAAAGAGAACTGGCCCCTGGGAGCCCC
  ATTGCCTCTGTCTCCTTCGGTGCCTGCAGAGACTTTGTCTTCCGGCATAAGGATTCCCGTGGGAAAAGCC
  CCTCCAGGAGGGTGGCGGTGGTCAGGCTGCCGCTGGCCCACGGGAGCTTACTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001205179
• ORF Size: 474 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001205179.1, NP_001192108.1
• RefSeq Size: 904
• RefSeq ORF: 474
• Locus ID: 121642
• Protein Families: Druggable Genome
• Gene Summary: The Escherichia coli AlkB protein protects against the cytotoxicity of methylating agents by repair of the specific DNA lesions generated in single-stranded DNA. ALKBH2 and ALKBH3 (MIM 610603) are E. coli AlkB homologs that catalyze the removal of 1-methyladenine and 3-methylcytosine (Duncan et al., 2002 [PubMed 12486230]). [supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (4) differs in the 5' UTR and lacks a coding exon compared to variant 1. The resulting protein (isoform 2) is shorter but has the same N- and C-termini compared to isoform 1. Variants 4 and 5 encode the same protein.