RIC3 (NM_001206671) Human Untagged Clone

CAT#: SC331669

RIC3 (untagged) - Homo sapiens RIC3 acetylcholine receptor chaperone (RIC3), transcript variant 3


  "NM_001206671" in other vectors (2)

Reconstitution Protocol

USD 370.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "RIC3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RIC3
Synonyms AYST720; PRO1385
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001206671, the custom clone sequence may differ by one or more nucleotides


ATGGCGTACTCCACAGTGCAGAGAGTCGCTCTGGCTTCTGGGCTTGTCCTGGCTCTGTCGCTGCTGCTGC
CCAAGGCCTTCCTGTCCCGCGGGAAGCGGCAGGAGCCGCCGCCGACACCTGAAGGAAAATTGGGCCGATT
TCCACCTATGATGCATCATCACCAGGCACCCTCAGATGGCCAGACTCCTGGGGCTCGTTTCCAGAGGTCT
CACCTTGCCGAGGCATTTGCAAAGGCCAAAGGATCAGGTGGAGGTGCTGGAGGAGGAGGTAGTGGAAGAG
GTCTGATGGGGCAGATTATTCCAATCTACGGTTTTGGGATTTTTTTATATATACTGTACATTCTATTTAA
GCTCTCAAAGGGGAAAACAACTGCAGAGGATGGGAAATGCTATACTGCCATGCCTGGAAACACCCACAGG
AAAATTACCAGTTTTGAGCTTGCTCAACTGCAAGAAAAACTGAAGGAGACAGAAGCAGCCATGGAAAAAT
TAATCAACAGAGTGGGACCTAATGGTGAGAGCAGAGCACAGACTGTGACTTCTGACCAAGAGAAACGGTT
GCTACATCAGCTCCGAGAAATCACCAGGGTCATGAAAGAAGGAAAATTCATTGACAGATTTTCTCCAGAG
AAAGAAGCTGAGGAGGCCCCTTACATGGAGGACTGGGAAGGTTACCCTGAAGAGACTTACCCAATTTATG
ACCTTTCAGACTGTATCAAGCGTAGGCAAGAAACAATCTTGGTGGATTACCCTGACCCAAAAGAACTTTC
TGCTGAAGAAATAGCTGAAAGAATGGGAATGATAGAAGAGGAAGAATCAGATCATTTGGGTTGGGAAAGT
CTGCCCACTGACCCCAGAGCCCAGGAAGATAATTCTGTTACCTCGTGTGATCCAAAGCCAGAAACATGTT
CCTGCTGTTTTCATGAAGACGAGGATCCTGCTGTCTTGGCAGAGAATGCTGGATTCAGTGCAGATAGCTA
CCCTGAGCAAGAGGAAACCACCAAAGAAGAGTGGTCCCAAGACTTTAAAGATGAAGGGTTGGGCATCAGC
ACCGATAAAGCATATACAGGCAGCATGCTGAGGAAGCGTAACCCCCAGGGTTTAGAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001206671
ORF Size 1110 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001206671.2, NP_001193600.1
RefSeq Size 5830
RefSeq ORF 1110
Locus ID 79608
Protein Families Transmembrane
Gene Summary This gene encodes a member of the resistance to inhibitors of cholinesterase 3-like family which functions as a chaperone of specific 5-hydroxytryptamine type 3 receptor and nicotinic acetylcholine receptor subtypes. The encoded protein influences the folding and assembly of these receptor subunits in the endoplasmic reticulum and expression on the cell surface. This protein contains an N-terminal transmembrane domain, a proline-rich spacer, and a cytosolic C-terminal coiled-coil domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Transcript Variant: This variant (3) uses an alternate in-frame splice site in the coding region, compared to variant 1. The encoded isoform (a) is longer than isoform c. The isoform designation was changed from 'c' to 'a' to be consistent with isoforms cited in PMID 18691158. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.